ijcs International Journal of Cardiovascular Sciences Int. J. Cardiovasc. Sci. 2359-5647 2359-4802 Sociedade Brasileira de Cardiologia WBktZXKnsrrkbQ9KBmBYg5L S2359-56472017000300207 10.5935/2359-4802.20170047 Original Articles Gallic Acid and Cyclosporine Mixture and their Effects on Cardiac Dysfunction Induced by Ischemia/Reperfusion and eNOS/iNOS Expression Badavi Mohammad 1 2 4 Sadeghi Najmeh * 3 Dianat Mahin 1 4 Samarbafzadeh Alireza 4 Ahvaz Jundishapur University of Medical Sciences Physiology Research Center Department of Physiology Iran Physiology Research Center, Department of Physiology, Ahvaz Jundishapur University of Medical Sciences Ahvaz Jundishapur University of Medical Sciences Ahvaz Jundishapur Arteriosclerosis Research Center Golestan Hospital Iran Arteriosclerosis Research Center, Golestan Hospital, Ahvaz Jundishapur Ahvaz Jundishapur University of Medical Sciences Jahrom University of Medical Sciences Faculty of Medicine Department of Physiology Jahrom Iran Department of Physiology, Faculty of Medicine, Jahrom University of Medical Sciences, Jahrom Ahvaz Jundishapur University of Medical Sciences Faculty of Medicine Department of virology Ahvaz Iran Infectious and Tropical Research Center, Department of virology, Faculty of Medicine, Ahvaz Jundishapur University of Medical Sciences, Ahvaz - Iran Ahvaz Jundishapur University of Medical Sciences Mailing Address: Najmeh Sadeghi, Department of Physiology, Faculty of Medicine, Jahrom University of Medical Sciences, Jahrom - Iran. E-mail: najmeh.sadeghi@gmail.com Corresponding author

Author contributions

Conception and design of the research: Dianat M. Acquisition of data: Sadeghi N. Analysis and interpretation of the data: Dianat M. Statistical analysis: Sadeghi N. Obtaining financing: Badavi M. Writing of the manuscript: Sadeghi N. Critical revision of the manuscript for intellectual content: Badavi M. Análise das bandas genéticas: Samarbafzadeh A.

Potential Conflict of Interest

No potential conflict of interest relevant to this article was reported.

 May-Jun 2017 30 3 207 218 29 04 2016 19 09 2016 06 03 2017 This is an Open Access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Abstract Background:

Although many researches have been conducted on either a certain antioxidant or mPTP individually, little attention has been drawn to the effects of co-administration of an antioxidant and mPTP inhibitor together on cardiac dysfunction after I/R injury.

 Objectives:

This study aims at determining the effects of gallic acid (as Antioxidant) combined with cyclosporine A (CsA) (as mPTP inhibitor) on I/R induced cardiac and endothelial (role of NO) dysfunction.

 Methods:

Male Wistar rats were pretreated with gallic acid (7.5, 15, or 30 mg.kg-1 body weight, daily) for a period of 10 days. Then, the heart was isolated and exposed to 30-minute ischemia and perfused by CsA (0.2 µM) 20 min during reperfusion period.

 Results:

The data have shown that infarct size was decreased significantly by CsA and gallic acid alone (p < 0.05, one way ANOVA followed by LSD test), however the combination of both drugs had more significant improving effects (p < 0.001). The combination of these two drugs improved more significantly maximum rate of rise and fall of ventricular pressure (±dp.dt-1 max), rate pressure product (RPP), left ventricular developed pressure (LVDP), heart rate and coronary flow rather than applying each one alone (p < 0.05, repeated measurement ANOVA followed by LSD test).

 Conclusions:

In conclusion, benefiting from an antioxidant concomitant with an mPTP inhibitor could have more improving effects on the cardiac dysfunction induced by I/R injury.

 Keywords: Antioxidants Gallic Acid Cyclosporine Ventricular Function Endothelium Reperfusion Rats Nitric Oxide Synthase Introduction

The disrupted supply of oxygen accompanied by myocardial ischemia leads to mitochondrial decline in electron transport chain (ETC) flux whose result is the subsequent mitochondrial swelling and degeneration. Then, ATP is depleted, so necrotic and mitochondrial death pathway occurs with the opening of mitochondrial permeability transition pore (mPTP).1-3

The concept of myocardial cell injury occurring after ischemia/reperfusion (I/R) involves two major hypotheses: increases in intracellular calcium and/or the accumulation of reactive oxygen species (ROS). The latter causing the sarcolemmal peroxidation of the cellular phospholipid layer, leads to the loss of cellular integrity and facilitating calcium entry. During reperfusion, calcium enters the mitochondria in response to a variety of stimuli and can modulate the opening of the mPTP shown with its accessory components.2,4

NO is an important vascular tone modulator. Functional damage in the endothelium due to peroxynitrite formation is the aftermath of combining ROS with NO. This toxic compound can result in the initiation of apoptotic cell death.5 Prior studies revealed that red wine extract and antioxidant treatment significantly improved post ischemic ventricular and contractil function.6,7 To reduce lethal reperfusion injury, new cardioprotective strategies, including preconditioning with antioxidants and inhibitors of the Mptp,8 have been applied. One of the fundamental mechanism involving the opening of K+ ATP channels in the mitochondria results in the blockade of ischemia-induced collapse of the mPTP, and thereby leads to the preservation of mitochondrial function and cellular ATP.8,9

Previous studies have demonstrated that gallic acid, a metabolite of propyl gallate, improves antioxidant status and protects the heart and lysosome membrane against isoproterenol-induced oxidative stress in rats.10 Moreover, the perfusion of polyphenol (-)-epigallocatechin gallate (EGCG) during ischemia significantly reduced infarct size (50%) after reperfusion. It should be noted that the mitochondrial K+ATP channels played a crucial role in cardioprotection induced by EGCG.11 Gallic acid treatment, showed in Ananya (2012), improved ulcer healing by increasing eNOS/iNOS ratio.12 In another study, Gallic acid induced eNOS expression and modulated the endothelium-dependent vasodilation and vasoconstriction.13 eNOS with anti-inflammatory role could protect the cell against I/R injury by increasing the NO production.13

However, literature survey has shown that there are no scientific reports available on the antioxidant effects of gallic acid on hemodynamic parameters or NOS expression after I/R injury.

In addition, it has been unraveled that the inhibition of mPTP by cyclosporine A preserved mitochondrial morphology after myocardial ischemia/reperfusion, limited myocyte necrosis and apoptosis, and reduced infarct size (60%).14

In accordance with the aforementioned facts, oxidative-stress-induced opening mPTP casts a pivotal role in lethal perfusion injury which is a cornerstone in cardioprotection. Therfore, the main object of this study was to investigate the effect of combination of gallic acid as a powerful antioxidant and cyclosporine A as a mPTP inhibitor on cardiac hemodynamic dysfunction , infarct size and the NOS expression after ischemia/reperfusion in rats' isolated heart.

 Material and Methods Ethical approval

The protocols and procedures of the present study were approved by the animal care and use committee of the Ahvaz Jundishapur University of Medical Sciences (AJUMS.REC.1392.222).

 Animals

The experiments were conducted on ninety male Wistar rats weighing (250-300g) obtained from animal house of Ahvaz Jundishapur University of Medical Sciences, Ahwaz, Iran. The animals were randomly divided into the following 9 groups (Table 1). In each group 10 rat were chosen using Cochran formula. Different doses of gallic acid were dissolved in saline and administered once a day for 10 days orally via a gavage needle.10 All groups were maintained under the same conditions (temperature controlled room 22±2ºC, with a 12 h dark- light cycle supplied with food and water ad libitum).

Animals groups that have used in this study (n= 10)
Groups1 Gallic acid (mg/kg) Cyclosporine (µM)
Sham2
C1 CaCb SalineSaline 00.2
G1 G1aG1b 7.57.5 00.2
G2 G2aG2b 1515 00.2
G3 G3aG3b 3030 00.2

C: control groups; G: groups that received gallic acid. This group wasn't exposed to ischemia / reperfusion.

We chose the sample size using Cochran formula. With using it the number of rat in each group was____. But we predicted some missing because of ischemia. So we selected 10 rat in each group.

Cochran formula was:

n = Z a 2 2 S 2 d 2

Drugs

Gallic acid , cyclosporine A (CsA), heparin, 2,3,5-triphenyl tetrazolium chloride (TTC), were purchased from Sigma (St. Louis, MO); sodium chloride, potassium chloride, magnesium sulphate, sodium hydrogen carbonate, potassium hydrogen orthophosphate, D-glucose and calcium chloride were obtained from Merck Laboratories, ketamine and xylazine from Alfasan Co (Woderen- Holland).

 Isolation and preparation of the heart

The animals were anesthetized by Ketamine HCL (50 mg.kg-1), xylazine (2-5 mg.kg-1) and to prevent blood clotting heparin (1000 U.kg-1, IP) was injected. The trachea was cannulated and the animals were ventilated with room air using a rodent ventilator (UGO BASILE, model: 7025).15 The chest was opened and the ribs were removed, and then a steel cannula was placed into the aorta and secured with a suture. The heart was immediately perfused with Krebs-Henseleit solution. Then, the heart was quickly excised and transferred to a Langendorff apparatus while it was continuously perfused with the solution at a constant (60-70 mmHg) pressure and temperature (37°C). Before starting the experiments, the buffer was bubbled with 95% O2-5% CO2 to attain a pH of 7.4.

A water-filled latex balloon was connected to a pressure transducer by a stainless steel needle was introduced through the left atrium into the left ventricle to measure left ventricular pressure (LVP). The heart was placed in a jacketed glass chamber at 37°C temperature and provided with a 25-to 30-min period to reach equilibrium before any experiment. The balloon volume was adjusted in a way that a LV end diastolic pressure (EDP) reaches to 5-10 mmHg. A Power lab system (Power lab, AD instrument, Australia) was used to analyze the signal from the pressure transducer. Left ventricular developed pressure (LVDP), left ventricular systolic pressure (LVSP), ventricular EDP, maximum rate of rise (+dp.dt-1 max) and maximum rate of fall (-dp.dt-1 max) of LVP, and the rate-pressure product (RPP; product of LVDP and heart rate) and lead II of ECG were recorded. All hearts were perfused for 25-30 min before the induction of ischemia to allow the stabilization of LVP and Coronary Perfusion Pressure (CPP). Next, they were subjected to a 30-min no flow global ischemia, followed by 60 min of reperfusion.16 The successful induction of ischemia was determined by ST elevation on the electrocardiogram. Heart rate and perfusion pressure were constantly monitored.15 CsA was dissolved in ethanol and added to perfusion solution. After 30 min of ischemia, the hearts were reperfused with 0.2 µM of CsA for 10 min and then the reperfusion continued with ordinary Krebs-Henseleit solution buffer.17 The above mentioned cardiac parameters were measured at the end of ischemia and at every 15 minutes during reperfusion period.

 Determination of infarct size

At the end of the above mentioned experiments, the heart was sliced (2 mm thick) and incubated with 1% TTC for 20 minute at 37°C temperature. Then, the slices were incubated in 10% formalin for 60 minutes. Next, the infarct area was measured by calculating the percentage of the total area of slice on both sides and via using image analysis software (NIHimagepro.1.16).17

Evaluation of eNOS mRNA expression

Tissue samples were frozen for 1 month. On the experimental day, the total RNA was extracted from the frozen tissue samples using Trizole reagent (Roche Diagnostics, Indianapolis, IN). The concentration of the total RNA was determined by spectrophotometry (Bio Photometer Plus, Eppendorf, Hamburg, Germany). We read the RNA at 230 and 260nm. The samples which were in 1.9-2.1 mm were selected to continue the assessment. The others were excluded of the study.

The cDNA, according to the manufacturer's instruction, was synthesized from 1 µg of the total RNA with the Reverse Transcription kit (Fermentase, England).

Reverse-transcribed polymerase chain reaction (RT-PCR) was performed to determine mRNA levels of the constitutive (endothelial) (eNOS) and inducible nitric oxide synthase (iNOS) isoforms in rats' ventricular tissue.18

PCR amplification

Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was amplified from the same amount of RNA to evaluate a variety of different samples in comparison to the control group. The PCR solution contained 10 µl of first-strand cDNA, 5µl 10X PCR buffer, 10mM MgCl2, 25 Pico mole of both sense (5_-ACC ACA GTC CAT GCC ATC AC-3_) and antisense (5_-TCC ACC ACC CTG TTG CTG TA-3_) GAPDH primers.19 It yielded 400 bp of GAPDH, 25picomole of both sense (5_-CGA GAT ATC TTC AGT CCC AAG C-3_) and antisense (5_-GTG GAT TTG CTG CTC TCT AGG-3_) eNOS primer,19 which yielded 200 bp of eNOS, and 25Pico mole of sense (5'CACCTTGGAGTTCACCCAGT3)`and antisense (5'ACCACTCGTACTTGGGATGC3) iNOS primer,20 which yielded 220 bp of iNOS message, 5U/µl Termophylus Acquaticus (Taq) DNA polymerase (Cinagen, Iran,), and water to a final volume of 50 µl.

The cycling program consisted of incubation at 95˚C for 3 min (eNOS and GAPDH) and at 94˚C for 45s for (iNOS) to active DNA Taq polymerase and 35 two-step cycles with denaturation at 60˚C for 60 s (eNOS and GAPDH) and 60˚C for 45s (iNOS) and annealing/ extension at 72˚C for 10 min for all of them. The template negative control (H2O) was routinely run in every PCR. PCR products were run on 2% agarose gel electrophoresis and photographed after ethidium bromide staining under UVlight. Expression levels of all genes were normalized against GAPDH expression (internal calibrator for equal RNA template loading and normalization). Using a computerized densitometric system (Image J),18 bands on the gel were scanned and quantified.

 Statistical analysis

The results were analyzed by using SPSS version 16 and expressed as Mean±SEM. Comparisons between groups were performed using one-way ANOVA or repeated-measurement ANOVA followed by LSD multiple comparison test. P-values of less than 0.05 were considered significant. Normality was checked using Kolmogorov Smirnov test. We accessed the hemodynamic changes between control group and others during the 2 hours of test. This time included the pre ischemia period, ischemia and reperfusion. During this time we recorded the changes repeatedly. The main aim was to compare this changes between control and treated groups. So comparison within each group was not performed.

 Results Effects of Gallic Acid +CsA on myocardial function

Myocardial contractility (shown as ±dp.dt-1) was decreased in almost all groups, as shown in Table 2. Although pretreatment with gallic acid (7.5-30 mg.kg-1) alone had no significant effects, CsA improved the contractility significantly compared with control (p<0.01). Nevertheless, the combination of gallic acid (15 mg.kg-1) and CsA had more significant improving effects on the contractility (p<0.001). Also the combined form improved contractility compared with only CsA (p<0.05) and no significant effect with gallic acid alone.

Hemodynamic parameters during pre-ischemia and reperfusion (60 min of post ischemia) periods of ischemia-reperfusion protocol
Group1 +dp/dt -dp/dt LVDP LVSP RPP CF HR
Ctrl Pre 2991.2±384 1615.5±237.5 90±15.1 95.5±15.2 27989.5±5499.9 11.2±1 273.7±12.6
Post 605.6±72.3 291.7±37.4 22.9±2.9 33.3±5.3 4319.2±394 4.1±0.5 171.2±15.6
G 7.5 Pre 2342.7±278.9 1067.4±152.4 68.4±9.1 74±9.1 18084.8±3672.1 11.8±1.1 236±10.5
Post 1358.3±546.9 504.2±215.6 41.2±14.3 59.5±11.5 8970.4±3516.9 6.2±1.5 200.8±21.9
G 15 Pre 2801.2±312.6 1242.7±131.5 67.3±5.1 74.2±5.2 19349.7±1273.5 11.7±0.8 281.3±9.1
Post 820.5±134 321.7±59.6 25.2±3.4 37.5±4.2 3934.6±903.7 5.4±1 152.8±18.3
G 30 Pre 2367.3±210.8 1507.9±568.7 64.4±7.9 71.9±7.8 18409.3±2323.4 10.3±1 257.7±13.3
Post 840±141.4 306.9±56.3 39±8.3 51.8±7 6271.9±2153.9 5±0.6 151.6±24
CsA Pre 3036.4±374.5 1470.2±236.2 82.1±10.2 88.1±9.9 23409.6±2442.3 10.4±1.2 292±14
Post 1510±319.9** 670±142.1 36.3±7.6 53.5±7.1 8881±1623.9 7.6±0.9*(p=0.006) 210.9±19.1
G 7.5+ CsA Pre 2477.9±192.7 1165.6±168.6 66.6±5 72.1±5.7 15614.3±1681.6 10.4±1.1 234±16.6
Post 1016.6±225.9 402.8±128.8 63.8±7**(p=0.003) 73.8±20.1*(p=0.01) 11486.5±5450.9*(p=0.02) 5.3±1.3 193.9±19.6
G 15+ CsA Pre 2764.9±208 1614.4±213.5 89.1±13 94±12 23173.8±3674.2 10.7±1.2 243.6±9.2
Post 2142.1±314.9**, #(p=0.007) 841.4±109.5*,#(p=0.03) 54.1±8.3**(p=0.007) 88.8±10.3**(p=0.002) 10063±1601.6**(p=0.001) 7.7±1.9**(p=0.007) 187±17.2
G 30+ CsA Pre 2554.4±180 1164.4±123.9 72.5±7 78.9±7.2 20498±2285.7 8.6±1 283.2±17.7
Post 911.3±198.2 327.6±77.4 22.6±4.4 35.8±6.1 4462±1050.4 6.5±1.5 186.8±24

Ctrl: control group, G7.5: gallic acid (7.5 mg/kg), G15: gallic acid (15 mg/kg), G30: gallic acid (30 mg/kg), CsA: cyclosporine A, G7.5+CsA (gallic acid (7.5 mg/kg)+ CsA), G15+CsA (gallic acid (15 mg/kg)+ CsA), G30+CsA (gallic acid (30 mg/kg)+ CsA), +dp/dt: Maximum rate of rise of left ventricular pressure, - dp/dt: Minimum rate of rise of left ventricular pressure, LVDP: left ventricular developed pressure, RPP: rate of pressure product, CF: coronary flow HR: heart rate, pre: pre ischemia, post: post ischemia.

p < 0.05: compared with control,

p < 0.01: compared with control,

*** p < 0.001: compared with control.

compared with CsA alone.

Furthermore, different doses of gallic acid or CsA alone had no significant effects on LVDP, while the administration of gallic acid (7.5 and 15 mg.kg-1) + CSA improved LVDP significantly (p<0.05, Table 2). The LVSP was increased by gallic acid (7.5 and 15 mg.kg-1) pretreatment in combination with CsA (p<0.05); but the combined effect of 15 mg.kg-1 gallic acid + CsA was more significant than that of gallic acid (7.5 mg.kg-1) pretreatment + CsA compared with control (p<0.01, Table 2). This rising was not significant in comparison with CsA or gallic alone.

The rate pressure product (RPP) was decreased in almost all groups, as shown in Table 2. Although pretreatment with gallic acid (7.5-30 mg.kg -1) alone had no significant effects on RPP, the combination of gallic acid (15 +CsA mg.kg -1) and CsA improved it significantly compared with control (P<0.001). In this case, comparison of combinations treats with CsA or gallic alone was not significant.

 Coronary flow

Coronary flow decreased in all groups during the post-ischemic reperfusion compared to pre-ischemia. The administration of gallic acid (15mg.kg-1) + CsA and CsA improved the coronary flow significantly toward normal pre-ischemic value compared with control (Table 2). However, other doses of gallic acid alone or in a combined form had no significant effects on the coronary flow compared with control or CsA alone. Also the gallic acid alone had not significant effect in comparison with its combined form.

 Heart rate

At the beginning of the experiment, the rate of isolated heart in all groups was not different from one another (pre ischemia period). However, at the end of reperfusion, the heart rate of all groups was reduced significantly compared with control (p<0.05, Table 2) but this reduction was not significant in comparison with CsA or gallic acid alone. Nevertheless, the administration of CsA alone increased the heart rate slightly during the first 60 minutes of reperfusion.

 Effects of Gallic Acid +CSA on myocardial infarct size

Myocardial infarct size was expressed as the percentage ratio of the infarct area to the total area. This ratio was 26.74 ± 2.3 % for the control group subjected to 30 min of ischemia and 1h of reperfusion (Figure 1). In spite of the fact that there was a significant reduction in the infarct size for those groups that received gallic acid 15,30mg.kg -1 or CsA alone (p<0.05, one way ANOVA followed by LSD), this reduction for those groups receiving gallic acid (15 or 30 mg.kg -1 doses) +CsA was much more significant compared to control (p<0.001, one way ANOVA followed by LSD). There was no significant decrease between combined form compared with CsA or gallic acid alone.

Effects of Gallic acid and/or cyclosporine A (CsA) on myocardial infarct size (means ±SEM, n=10) of different groups of rats.

The animals received three different doses of gallic acid (7.5, 15 and 30 mg/kg) for 10 days prior to isolation of the heart and induction of ischemia (30 min) and reperfusion (1 h) without or with CSA (0.2 µM, 10 min before and during reperfusion). Control animals received normal saline as the solvent of gallic acid. Myocardial infarct size expressed as the ratio of the infarct area to the total risk area in percentage.* Indicates significant difference with control group (*p<0.05, *** p<0.001, n=10 per group one way ANOVA followed by LSD test).

 Effects of Gallic Acid and Cyclosporine on eNOS and iNOS mRNA expressions

The analysis of PCR results revealed that ischemia /reperfusion decreased the levels of mRNA expression of eNOS in control group in comparison with Sham operated rats, but mRNA expression of iNOS increased in control group compared to sham. The mRNA levels of eNOS were significantly increased in gallic acid-treated (G7.5, G15 and G30 mg/kg) animals or those treated with CsA (0.2µM) alone, compared to the control group (p<0.001; Fig. 2a). The highest levels of mRNA expression of eNOS were observed in the administration of concomitant gallic acid and CsA compared with control. (p<0.001; Fig. 2a). The mRNA expression elevation was not significant in comparison with CsA or gallic alone.

Effects of gallic acid and cyclosporine on myocardial (a) eNOS and (b) iNOS.

mRNA expression.

iNOS mRNA expression was decreased significantly using gallic acid (G15 and G30 mg/kg) or CsA alone compared to that of control group, however the combination of both drugs induced more reduction with lower doses of gallic acid (G7.5+CsA , G15 + CsA) (p<0.001; Fig. 2b) and supplementary figure. The mentioned changes were not significant in comparison with CsA or gallic alone.

Data was expressed as the mean ± SEM. The animals received three different doses of gallic acid (7.5, 15 and 30 mg.kg-1) for 10 days prior to the isolation of the heart and the induction of ischemia (30 min) and reperfusion (1 h) without or with CSA (0.2 µM, 10 min before and during reperfusion). Analysis of quantitative PCR results revealed that the administration of gallic acid reduced mRNA expression of iNOS but it increased that of eNOS.

For the description of experimental groups, see caption to Figure 2a, and b. Asterisks indicate a significant difference. ***p<0.001 as compared to the control group (n=6).

 Discussion

As expected, the cardiac functions such as contractility, RPP, coronary flow and LVDP reduced during ischemia and reperfusion. The results of this study have shown that although the pretreatment of animals with gallic acid alone, as an antioxidant, reduced the infarct size, it had not significant effects on cardiac functions. Furthermore, the reperfusion of the heart with CsA improved cardiac functions partially, and reduced the size of infarction. Nevertheless, the combination of both drugs had more significant effects on the cardiac performance and the reduction of infarct size.

The fourth object was measuring the infarct size. Other studies showed that this parameter increased after 3 hours of reperfusion compared with 1 hour21 with TTC staining. So we evaluated it after 1 hour of reperfusion in according with our study main objects (investigation the changes during early of reperfusion not late).

Under normal conditions, there is a balance between the formation of pro-oxidants and the amount of antioxidants. During I/R, the impairment of myocardial function is mainly attributed to the interruption of the aforementioned balance and the elevation of ROS production.22 It has been shown that the excessive ROS could lead to peroxynitrite formation from NO radicals in response to its combination with superoxide anion and damage the cells in vascular and cardiac tissues.23 Furthermore, lipid peroxidation of cell membrane exacerbates the cell energy depletion due to the damage of mitochondrial enzymes. In addition, nucleic acids, cell membrane integrity, sarcoplasmic reticulum (SR) and Na+-Ca2+ exchanger function are damaged, so that intracellular and mitochondrial Ca2+ overloads occur.24 Following these events, the excess of Ca2+ induces mitochondrial enzymes dysfunction, membrane depolarization and opens the mPTP in the heart myocytes.2 During ischemia, because of disruption of electron transport chain (ETC), ATP production is impaired and the cell is depleted of high energy phosphates.25 Following these injuries, due to anaerobic metabolism and the accumulation of lactate and pyruvate, the intracellular acidosis is increased, and then the uncoupling of oxidative phosphorylation occurs which, in turn, leads to mitochondrial swelling. This vicious cycle leads to necrotic cell death and cardiac dysfunction.26 After the opening of the mPTP, cytochrome C is released into the cytosol, interacts with apoptosis protease activating factor-1(APAF-1) and leads to the activation of the caspase-9 which activates caspase 3 that is a key executor for apoptotic signaling.27

During the last few years, some cardio protection strategies have been applied to reduce the lethal injuries of I/R, including pre- and post-conditioning by antioxidants, by activators of the reperfusion injury salvage kinase pathway (RISK), by inhibition of protein kinase c-delta and ultimately by mPTP inhibitors such as CsA or sanglifehrin A.28 In this study, our strategy was to protect the heart by using antioxidant and prevent from opening the mPTP. By means of this, we hypothesized that the cell can be insulated against the previously mentioned vicious cycle that leads to the opening of mPTP, and then to the disruption of ATP production.26

Previous studies have shown that gallic acid could improve antioxidant status through the inhibition of lipid peroxidation and that it protects the heart and lysosome membrane against isoproterenol-induced oxidative stress in rats.29 In addition, during I/R, the administration of Polyphenol (-)-epigallocatechin gallate (EGCG) significantly reduced infarct size by 50% and the mitochondrial KATP channels played a crucial role in cardio protection induced by EGCG.30 Also, EGCG inhibits the transcription of inducible nitric oxide synthase.31 On the other hand, it was reported that mPTP inhibition by CsA maintained mitochondrial morphology after I/R injury in rabbits and that it limited myocyte necrosis and apoptosis.32

It has shown that reperfusion had some deleterious effects due to ROS production and PH disturbances during ischemia period. These phenomenon is time dependent and can led to cell death and myocardial injury which is called 'lethal reperfusion injury'.8 In this study we had several aims. The first of our aims was to investigate the eNOS expression during early reperfusion time. Also other studies have suggested that eNOS expression increased time- dependently during the early of reperfusion (1 hour) and iNOS expression in late of it (3-24 h). This rising has some deleterious effects via NO production. The NO reacts with ROS which were produced during ischemia and formed a lot of ONOO- which was led to cell apoptosis.33 NO has a bidirectional effects: moderate values of it has protective effects but a high level is harmful. Second goal was to find one of mechanisms on how antioxidants can improve the hemodynamic and endothelial dysfunction via NO production and its source during early reperfusion (protective eNOS pathway).34 So we selected one hour of reperfusion which is related to eNOS activity. Third: we measured the enzymatic activity for assessment of oxidative stress and cellular damage due to myocardial infarction in the immediately reperfusion period when typically it is at its greatest35 and published its result which the most changes was during first 15 min of reperfusion36 so we measured these parameters every 15 min like other studies method35 because the I/R injury was worsened by the time and our object was to investigate the preventive role of antioxidant or mPTP inhibitor and combined effect of both during total time of experiment . We were going to check the severity of I/R injury after 60 min of reperfusion when the No production derived from eNOS was affected by pretreatment with different doses of antioxidant37,38 only or in combination with a mPTP inhibitor (CsA). Because other studies have shown that inhibition of mitochondria permeability transition pore with this drug can prevents the eNOS expression.39 We concluded that our antioxidant (gallic acid) modulated the I/R injury via NO production and this NO was derived from eNOS not iNOS. Investigation of hemodynamic changes during late reperfusion was not the main aim of our study.

Although having observed that the flow increased insignificantly during reperfusion in the hearts of animals pretreated by gallic acid alone, we concluded that its combination with CsA had more significant effects. The above-mentioned improvement in cardiac function, observed in our study, could be attributed to antioxidant effects of gallic acid. It seemed that scavenging of ROS by gallic acid already reported10 could protect the cells against oxidative and nitrosative stress. In addition, by inhibition of proxy nitrite production, it could maintain the endothelium function and vascular tone. Previous studies showed that gallic acid increased eNOS expression.2 An increase in iNOS activity and a decrease in eNOS activity during ischemia were related to I/R injuries. Our results showed that post-ischemia iNOS expression in control group increased to 1.6 times as much as that of sham group. Treatment with gallic acid or CsA alone raised eNOS/iNOS original ratio by 2 times, but the combination of both drugs was more efficient. It is because eNOS expression was increased by 3 folds, using gallic acid with CsA, but iNOS expression reduced to one fourth. These results corresponded to those of other researchers that suggested the increasing of eNOS/iNOS ratio with a resveratrol analogue.40 Taken together, our results established that NO derived from eNOS probably modulated the blood flow and this effect is more efficient in the combination of gallic acid 15 mg/Kg with CsA]. In addition, eNOS expression increased by using all compounds could be attributed to enhanced bioavailability of NO during I/R injury.41 Furthermore, our results revealed that contractility (±dp.dt-1), RPP, LVDP and heart rate were improved in the groups perfused by CsA in combination with gallic acid pretreatment. This effect could be ascribed to the preservation of the mitochondria against ROS by increasing the antioxidant capacity with gallic acid and through the inhibition of mPTP opening by CsA. Thus, the ATP could be kept in the cell and the Ca2+ overload was prevented due to the enhanced uptake of Ca2+ into the SR by activating the RISK pathway. Therefore, the interaction of contractile elements with each other could be improved and become faster.42 However, using the highest dose of gallic acid (30 mg/kg) reversed these effects. According to another study, the process could be explained by a pro-oxidant effect of Gallic acid in high doses, because it has proved that ferric ion could chelate the hydroxyl group in Gallic acid molecule and reduce the oxidation potential, thereby it will lose its antioxidant activity.43 Also, contractility was increased with CsA alone but it didn't recover with G7.5+ CsA. This effect can be explained with I/R injury after 1 hour of reperfusion. Because 1-hour-reperfusion, contractility was decreased much more than that of 30-minute- reperfusion, so the injury became worse and the protective effect of CsA couldn't recover it to the level of 30-minute-reperfusion. On the other hand, by using higher dose of Gallic (G15+ CsA), the antioxidant system gets stronger and prevents ROS production in mitochondria.26 In fact, it is possible that CsA couldn't inhibit more mPTP which was opened by ROS produced due to I/R injury over the time.

Some of studies controled the heart rate with pacemaker. Also, this was a variable in our study. We were going to assess the changes of it during the experiment. So we didn't control it. Because of comparing this variable with control group, it couldn't make a bias in this study. (all groups were similar). The object was to investigate the hemodynamic parameters changes affected by I/R and pretreatment. So the heart rate was a variable that we wanted to evaluate it by it self without any intervention (using pace maker didn't satisfy this object). There are other studies using this method.35

Other studies showed that infarct size increased after reperfusion21 with TTC staining. So we evaluated it during the beggining of reperfusion.

In this study, the infarct size was significantly reduced by gallic acid or CsA alone (almost 15%) but this reduction was more significant by the concomitant administration of these two drugs (almost 25%). This effect could be attributed to the activation of a protein kinases group which improved uncoupling oxidative phosphorylation and prevented the swelling of the mitochondria and cell death.44 mPTP inhibition brought about the activation of the anti apoptotic and RISK pathways represented a mechanism for programmed cell survival. We also observed that the administration of both drugs improved the myocardial contractility more than the administration of each drug alone.

It has been already acknowledged that the CsA is not just an mPTP inhibitor. It also inhibits calcineurin which modulates mitochondrial death signaling. While other studies have reported that using FK506, a potent calcineurin inhibitor which is 100 times more potent than CsA, has not affected caspase activation. Therefore, the role of CsA in blocking the mitochondrial pores can be more important than its other roles. In addition, other studies have reported that using CsA at low doses has no toxic effects.45 We used the lowest dose of (0.2µM) which was much lower than that of (20 mg.kg-1) used by other studies,46 but it may be insufficient to inhibit the largest numbers of mPTP. Therefore, the effect of higher doses of the mPTP inhibitor that has laid unexplored hitherto, is highly liable to whet the appetite of interested, specialized researchers to set out further investigation of greater scrutiny.

 Conclusion

In conclusion, using gallic acid as an antioxidant concomitant with the preservation of mitochondria by CsA as an mPTP inhibitor in G15+CsA in comparison with control, could have more improving effects on cardiac dysfunction, iNOS and endothelial NOS expression induced by I/R injury.

 Study limitations

We had some limitations in our study, for example, our funding and facilities were very limited. So we couldn't do more experiments. For example, we couldn't did qPCR because of funding and instruments limitation. So we forced to do the experiments using the facilities which were available. In addition, we limited to measure the protein expression. Also, we had limitation for assessment the mitochondrial function or morphology.

 Ethical Approval

The protocols and procedures of the present study were approved by the animal care and use committee of the Ahvaz Jundishapur University of Medical Sciences (AJUMS.REC.1392.222).

Sources of Funding

This study was funded by the Research Affairs of Ahvaz Jundishapur University of Medical Sciences.

Study Association

This article is part of the thesis of PhD submitted by Najmeh Sadeghi, from Research Affairs of Ahvaz Jundishapur University of Medical Sciences.

 Acknowledgements

This research was supported by the Research Affairs of Ahvaz Jundishapur University of Medical Sciences (grant No. PRC 95) and was a part of the PhD thesis of Najmeh Sadeghi in physiology.

I express my thanks to Mrs. Khaghani, Maryam Rafiei and Kosar Bavarsad for their great help to me during my research.

 References 1 Hausenloy DJ, Opie L, Yellon DM. Dissociating HDL cholesterol from cardiovascular risk. Lancet. 2010;376(9738):305-6. Hausenloy DJ Opie L Yellon DM Dissociating HDL cholesterol from cardiovascular risk Lancet 2010 376 9738 305 306 2 Marin-Garcia J, Goldenthal MJ. Heart mitochondria signaling pathways: appraisal of an emerging field. J Mol Med. 2004;82(9):565-78. Marin-Garcia J Goldenthal MJ Heart mitochondria signaling pathways: appraisal of an emerging field J Mol Med. 2004 82 9 565 578 3 Hausenloy DJ, Baxter G, Bell R, Botker HE, Davidson SM, Downey J, et al. Translating novel strategies for cardioprotection: the Hatter Workshop Recommendations. Basic Res Cardiol. 2010;105(6):677-86. Hausenloy DJ Baxter G Bell R Botker HE Davidson SM Downey J Translating novel strategies for cardioprotection: the Hatter Workshop Recommendations Basic Res Cardiol. 2010 105 6 677 686 4 Marin-Garcia J, Goldenthal MJ. Mitochondria play a critical role in cardioprotection. J Card Fail. 2004;10(1):55-66. Marin-Garcia J Goldenthal MJ Mitochondria play a critical role in cardioprotection J Card Fail. 2004 10 1 55 66 5 Ceconi C, Boraso A, Cargnoni A, Ferrari R. Oxidative stress in cardiovascular disease: myth or fact? Arch Biochem Biophys. 2003;420(2):217-21. Ceconi C Boraso A Cargnoni A Ferrari R Oxidative stress in cardiovascular disease: myth or fact? Arch Biochem Biophys 2003 420 2 217 221 6 Das DK, Sato M, Ray PS, Maulik G, Engelman RM, Bertelli AA, et al. Cardioprotection of red wine: role of polyphenolic antioxidants. Drugs Exp Clin Res. 1999;25(2-3):115-20. Das DK Sato M Ray PS Maulik G Engelman RM Bertelli AA Cardioprotection of red wine: role of polyphenolic antioxidants Drugs Exp Clin Res. 1999 25 2-3 115 120 7 Sato M, Ray PS, Maulik G, Maulik N, Engelman RM, Bertelli AA, et al. Myocardial protection with red wine extract. J Cardiovasc Pharmacol.2000 5(2):263-8. Sato M Ray PS Maulik G Maulik N Engelman RM Bertelli AA Myocardial protection with red wine extract J Cardiovasc Pharmacol 2000 5 2 263 268 8 Buja LM, Weerasinghe P. Unresolved issues in myocardial reperfusion injury. Cardiovasc Pathol. 2010;19(1):29-35. Buja LM Weerasinghe P Unresolved issues in myocardial reperfusion injury Cardiovasc Pathol 2010 19 1 29 35 9 Yellon DM, Downey JM. Preconditioning the myocardium: from cellular physiology to clinical cardiology. Physiol Rev. 2003;83(4):1113-51. Yellon DM Downey JM Preconditioning the myocardium: from cellular physiology to clinical cardiology Physiol Rev. 2003 83 4 1113 1151 10 Stanely Mainzen Prince P, Priscilla H, Devika PT. Gallic acid prevents lysosomal damage in isoproterenol induced cardiotoxicity in Wistar rats. Eur J Pharmacol. 2009;615(1-3):139-43. Stanely Mainzen Prince P Priscilla H Devika PT Gallic acid prevents lysosomal damage in isoproterenol induced cardiotoxicity in Wistar rats Eur J Pharmacol 2009 615 1-3 139 143 11 Song DK, Jang Y, Kim JH, Chun KJ, Lee D, Xu Z. Polyphenol (-)-epigallocatechin gallate during ischemia limits infarct size via mitochondrial K(ATP) channel activation in isolated rat hearts. J Korean Med Sci. 2010;25(3):380-6. Song DK Jang Y Kim JH Chun KJ Lee D Xu Z Polyphenol (-)-epigallocatechin gallate during ischemia limits infarct size via mitochondrial K(ATP) channel activation in isolated rat hearts J Korean Med Sci 2010 25 3 380 386 12 Chatterjee A, Chatterjee S, Biswas A, Bhattacharya S, Chattopadhyay S, Bandyopadhyay SK. Gallic Acid Enriched Fraction of Phyllanthus emblica Potentiates Indomethacin-Induced Gastric Ulcer Healing via e-NOS-Dependent Pathway. Evid Based Complement Alternat Med. 2012;2012:487380. Chatterjee A Chatterjee S Biswas A Bhattacharya S Chattopadhyay S Bandyopadhyay SK Gallic Acid Enriched Fraction of Phyllanthus emblica Potentiates Indomethacin-Induced Gastric Ulcer Healing via e-NOS-Dependent Pathway Evid Based Complement Alternat Med. 2012 2012 487380 487380 13 Sanae F, Miyaichi Y, Hayashi H. Endothelium-dependent contraction of rat thoracic aorta induced by gallic acid. Phytother Res.2003;17(2):187-9. Sanae F Miyaichi Y Hayashi H Endothelium-dependent contraction of rat thoracic aorta induced by gallic acid Phytother Res. 2003 17 2 187 189 14 Leshnower BG, Kanemoto S, Matsubara M, Sakamoto H, Hinmon R, Gorman JH 3rd, et al. Cyclosporine preserves mitochondrial morphology after myocardial ischemia/reperfusion independent of calcineurin inhibition. Ann Thorac Surg. 2008;86(4):1286-92. Leshnower BG Kanemoto S Matsubara M Sakamoto H Hinmon R Gorman JH 3rd Cyclosporine preserves mitochondrial morphology after myocardial ischemia/reperfusion independent of calcineurin inhibition Ann Thorac Surg. 2008 86 4 1286 1292 15 Klawitter PF, Murray HN, Clanton TL, Angelos MG. Reactive oxygen species generated during myocardial ischemia enable energetic recovery during reperfusion. Am J Pysiol Heart Circ Physiol.2002;283(4):H1656-61. Klawitter PF Murray HN Clanton TL Angelos MG Reactive oxygen species generated during myocardial ischemia enable energetic recovery during reperfusion Am J Pysiol Heart Circ Physiol. 2002 283 4 H1656 H1661 16 Kinugasa Y, Ogino K, Furuse Y, Shiomi T, Tsutsui H, Yamamoto T, et al. Allopurinol improves cardiac dysfunction after ischemia-reperfusion via reduction of oxidative stress in isolated perfused rat hearts. Circ J. 2003; 67(9):781-7. Kinugasa Y Ogino K Furuse Y Shiomi T Tsutsui H Yamamoto T Allopurinol improves cardiac dysfunction after ischemia-reperfusion via reduction of oxidative stress in isolated perfused rat hearts Circ J. 2003 67 9 781 787 17 Xie JR, Yu LN. Cardioprotective effects of cyclosporine A in an in vivo model of myocardial ischemia and reperfusion. Acta Anaesthesiol Scand. 2007;51(7):909-13. Xie JR Yu LN Cardioprotective effects of cyclosporine A in an in vivo model of myocardial ischemia and reperfusion Acta Anaesthesiol Scand. 2007 51 7 909 913 18 Mard SA, Neisi N, Solgi G, Hassanpour M, Darbor M, Maleki M. Gastroprotective effect of NaHS against mucosal lesions induced by ischemia-reperfusion injury in rat. Dig Dis Sci. 2012;57(6):1496-503. Mard SA Neisi N Solgi G Hassanpour M Darbor M Maleki M Gastroprotective effect of NaHS against mucosal lesions induced by ischemia-reperfusion injury in rat Dig Dis Sci 2012 57 6 1496 1503 19 Di Napoli P, Di Giovanni P, Gaeta MA, Taccardi AA, Barsotti A. Trimetazidine and reduction in mortality and hospitalization in patients with ischemic dilated cardiomyopathy: a post hoc analysis of the Villa Pini d'Abruzzo Trimetazidine Trial. J Cardiovasc Pharmacol.2007;50(5):585-9. Di Napoli P Di Giovanni P Gaeta MA Taccardi AA Barsotti A Trimetazidine and reduction in mortality and hospitalization in patients with ischemic dilated cardiomyopathy: a post hoc analysis of the Villa Pini d'Abruzzo Trimetazidine Trial J Cardiovasc Pharmacol. 2007 50 5 585 589 20 Chun TY, Bloem LJ, Pratt JH. Aldosterone inhibits inducible nitric oxide synthase in neonatal rat cardiomyocytes. Endocrinology. 2003;144(5):1712-7. Chun TY Bloem LJ Pratt JH Aldosterone inhibits inducible nitric oxide synthase in neonatal rat cardiomyocytes Endocrinology 2003 144 5 1712 1717 21 Ito WD, Schaarschmidt S, Klask R, Hansen S, Schäfer HJ, Mathey D, et al. Infarct Size Measurement by Triphenyltetrazolium Chloride StainingVersus In VivoInjection of Propidium Iodide. J Mol cell Cardiol.1997;29(8):2169-75. Ito WD Schaarschmidt S Klask R Hansen S Schäfer HJ Mathey D Infarct Size Measurement by Triphenyltetrazolium Chloride StainingVersus In VivoInjection of Propidium Iodide J Mol cell Cardiol. 1997 29 8 2169 2175 22 Cui J, Juhasz B, Tosaki A, Maulik N, Das DK. Cardioprotection with grapes. J Cardiovasc Pharmacol. 2002;40(5):762-9. Cui J Juhasz B Tosaki A Maulik N Das DK Cardioprotection with grapes J Cardiovasc Pharmacol 2002 40 5 762 769 23 Falk JA, Aune SE, Kutala VK, Kuppusamy P, Angelos MG. Inhibition of peroxynitrite precursors, NO and O2, at the onset of reperfusion improves myocardial recovery. Resuscitation. 2007;74(3):508-15. Falk JA Aune SE Kutala VK Kuppusamy P Angelos MG Inhibition of peroxynitrite precursors, NO and O2, at the onset of reperfusion improves myocardial recovery Resuscitation 2007 74 3 508 515 24 Zweier JL, Talukder MA. The role of oxidants and free radicals in reperfusion injury. Cardiovasc Res. 2006;70(2):181-90. Zweier JL Talukder MA The role of oxidants and free radicals in reperfusion injury Cardiovasc Res 2006 70 2 181 190 25 Territo PR, Mootha VK, French SA, Balaban RS. Ca(2+) activation of heart mitochondrial oxidative phosphorylation: role of the F(0)/F(1)-ATPase. Am J Physiol Cell Physiol. 2000;278(2):C423-35. Territo PR Mootha VK French SA Balaban RS Ca(2+) activation of heart mitochondrial oxidative phosphorylation: role of the F(0)/F(1)-ATPase Am J Physiol Cell Physiol 2000 278 2 C423 C435 26 Kim JS, Jin Y, Lemasters JJ. Reactive oxygen species, but not Ca2+ overloading, trigger pH- and mitochondrial permeability transition-dependent death of adult rat myocytes after ischemia-reperfusion. Am J Physiol Heart Circ. 2006;290(5):H2024-34. Kim JS Jin Y Lemasters JJ Reactive oxygen species, but not Ca2+ overloading, trigger pH- and mitochondrial permeability transition-dependent death of adult rat myocytes after ischemia-reperfusion Am J Physiol Heart Circ. 2006 290 5 H2024 H2034 27 Kim JS, Qian T, Lemasters JJ. Mitochondrial permeability transition in the switch from necrotic to apoptotic cell death in ischemic rat hepatocytes. Gastroenterology. 2003;124(2):494-503. Kim JS Qian T Lemasters JJ Mitochondrial permeability transition in the switch from necrotic to apoptotic cell death in ischemic rat hepatocytes Gastroenterology 2003 124 2 494 503 28 Yellon DM, Hausenloy DJ. Myocardial reperfusion injury. N Engl J Med. 2007;357(11):1121-35. Yellon DM Hausenloy DJ Myocardial reperfusion injury N Engl J Med. 2007 357 11 1121 1135 29 Priscilla DH, Prince PS. Cardioprotective effect of gallic acid on cardiac troponin-T, cardiac marker enzymes, lipid peroxidation products and antioxidants in experimentally induced myocardial infarction in Wistar rats. Chem Biol Interact. 2009;179(2-3):118-24. Priscilla DH Prince PS Cardioprotective effect of gallic acid on cardiac troponin-T, cardiac marker enzymes, lipid peroxidation products and antioxidants in experimentally induced myocardial infarction in Wistar rats Chem Biol Interact 2009 179 2-3 118 124 30 Song DK, Jang Y, Kim JH, Chun KJ, Lee D, Xu Z. Polyphenol (-)-epigallocatechin gallate during ischemia limits infarct size via mitochondrial K(ATP) channel activation in isolated rat hearts. J Korean Med Sci.1997;25(3):380-6. Song DK Jang Y Kim JH Chun KJ Lee D Xu Z Polyphenol (-)-epigallocatechin gallate during ischemia limits infarct size via mitochondrial K(ATP) channel activation in isolated rat hearts J Korean Med Sci. 1997 25 3 380 386 31 Lin YL, Lin JK. (-)-Epigallocatechin-3-gallate blocks the induction of nitric oxide synthase by down-regulating lipopolysaccharide-induced activity of transcription factor nuclear factor-kappaB. Mol Pharmacol. 1997;52(3):465-72. Lin YL Lin JK (-)-Epigallocatechin-3-gallate blocks the induction of nitric oxide synthase by down-regulating lipopolysaccharide-induced activity of transcription factor nuclear factor-kappaB Mol Pharmacol 1997 52 3 465 472 32 Leshnower BG, Kanemoto S, Matsubara M, Sakamoto H, Hinmon R, Gorman Iii JH, et al. Cyclosporine preserves mitochondrial morphology after myocardial ischemia/reperfusion independent of calcineurin iinhibition. Ann Thorac Surg. 2008;86(4):1286-92. Leshnower BG Kanemoto S Matsubara M Sakamoto H Hinmon R Gorman Iii JH Cyclosporine preserves mitochondrial morphology after myocardial ischemia/reperfusion independent of calcineurin iinhibition Ann Thorac Surg. 2008 86 4 1286 1292 33 Xuan YT, Tang XL, Qiu Y, Banerjee S, Takano H, Han H, et al. Biphasic response of cardiac NO synthase isoforms to ischemic preconditioning in conscious rabbits. Am J Physiol Heart Circ Physiol.2000;279(5):H2360-71. Xuan YT Tang XL Qiu Y Banerjee S Takano H Han H Biphasic response of cardiac NO synthase isoforms to ischemic preconditioning in conscious rabbits Am J Physiol Heart Circ Physiol 2000 279 5 H2360 H2371 34 Desrois M, Durrans A, Caus T, Lan C, Clarke K, Cozzone PJ, et al. Modulation of the NO pathway during short or prolonged blood reperfusion following ischaemia in a heterotopic rat heart transplantation model. Transplant Proc.2004;36(5):1280-2. Desrois M Durrans A Caus T Lan C Clarke K Cozzone PJ Modulation of the NO pathway during short or prolonged blood reperfusion following ischaemia in a heterotopic rat heart transplantation model Transplant Proc. 2004 36 5 1280 1282 35 Ray PS, Martin JL, Swanson EA, Otani H, Dillmann WH, Das DK. Transgene overexpression of alphaB crystallin confers simultaneous protection against cardiomyocyte apoptosis and necEROis during myocardial ischemia and reperfusion. FASEB J.2001;15(2):393-402. Ray PS Martin JL Swanson EA Otani H Dillmann WH Das DK Transgene overexpression of alphaB crystallin confers simultaneous protection against cardiomyocyte apoptosis and necEROis during myocardial ischemia and reperfusion FASEB J 2001 15 2 393 402 36 Badavi M, Sadeghi N, Dianat M, Samarbafzadeh A. Effects of gallic Acid and cyclosporine a on antioxidant capacity and cardiac markers of rat isolated heart after ischemia/reperfusion. Iran Red Crescent Med J. 2014;16(6):e16424. Badavi M Sadeghi N Dianat M Samarbafzadeh A Effects of gallic Acid and cyclosporine a on antioxidant capacity and cardiac markers of rat isolated heart after ischemia/reperfusion Iran Red Crescent Med J 2014 16 6 e16424 37 Liang F, Gao E, Tao L, Liu H, Qu Y, Christopher TA, et al. Critical timing of l-arginine treatment in post-ischemic myocardial apoptosis-role of NOS isoforms. Cardiovasc Res. 2004;62(3):568-77. Liang F Gao E Tao L Liu H Qu Y Christopher TA Critical timing of l-arginine treatment in post-ischemic myocardial apoptosis-role of NOS isoforms Cardiovasc Res. 2004 62 3 568 577 38 Zhu D-Y, Deng Q, Yao H-H, Wang D-C, Deng Y, Liu G-Q. Inducible nitric oxide synthase expression in the ischemic core and penumbra after transient focal cerebral ischemia in mice. Life Sciences. 2002;71(17):1985-96. Zhu D-Y Deng Q Yao H-H Wang D-C Deng Y Liu G-Q Inducible nitric oxide synthase expression in the ischemic core and penumbra after transient focal cerebral ischemia in mice Life Sciences 2002 71 17 1985 1996 39 López - Ongil S, Hernández - Perera O, Navarro - Antolín J, Perez de Lema G, Rodríguez - Puyol M, Lamas S, et al. Role of reactive oxygen species in the signalling cascade of cyclosporine A - mediated up - regulation of eNOS in vascular endothelial cells. Br J Pharmacol. 1998;124(3):447-54. López - Ongil S Hernández - Perera O Navarro - Antolín J Perez de Lema G Rodríguez - Puyol M Lamas S Role of reactive oxygen species in the signalling cascade of cyclosporine A - mediated up - regulation of eNOS in vascular endothelial cells Br J Pharmacol 1998 124 3 447 454 40 Guha P, Dey A, Chatterjee A, Chattopadhyay S, Bandyopadhyay SK. Pro-ulcer effects of resveratrol in mice with indomethacin-induced gastric ulcers are reversed by L-arginine. Brit J Pharmacol. 2010;159(3):726-34. Guha P Dey A Chatterjee A Chattopadhyay S Bandyopadhyay SK Pro-ulcer effects of resveratrol in mice with indomethacin-induced gastric ulcers are reversed by L-arginine Brit J Pharmacol 2010 159 3 726 734 41 Toda N, Toda H. Coronary hemodynamic regulation by nitric oxide in experimental animals: recent advances. Eur J Pharmacol. 2011;667(1-3):41-9. Toda N Toda H Coronary hemodynamic regulation by nitric oxide in experimental animals: recent advances Eur J Pharmacol 2011 667 1-3 41 49 42 Hausenloy DJ, Ong SB, Yellon DM. The mitochondrial permeability transition pore as a target for preconditioning and postconditioning. Basic Res Cardiol. 2009;104(2):189-202. Hausenloy DJ Ong SB Yellon DM The mitochondrial permeability transition pore as a target for preconditioning and postconditioning Basic Res Cardiol 2009 104 2 189 202 43 Shinno E, Shimoji M, Imaizumi N, Kinoshita S, Sunakawa H, Aniya Y. Activation of rat liver micEROomal glutathione S-transferase by gallic acid. Life Sciences. 2005;78(1):99-106. Shinno E Shimoji M Imaizumi N Kinoshita S Sunakawa H Aniya Y Activation of rat liver micEROomal glutathione S-transferase by gallic acid Life Sciences 2005 78 1 99 106 44 Hausenloy DJ, Yellon DM. Reperfusion injury salvage kinase signalling: taking a RISK for cardioprotection. Heart Fail Rev. 2007;12(3-4):217-34. Hausenloy DJ Yellon DM Reperfusion injury salvage kinase signaling: taking a RISK for cardioprotection Heart Fail Rev 2007 12 3-4 217 234 45 Hausenloy DJ, Duchen MR, Yellon DM. Inhibiting mitochondrial permeability transition pore opening at reperfusion protects against ischaemia-reperfusion injury. Cardiovasc Res. 2003; 60(3):617-25. Hausenloy DJ Duchen MR Yellon DM Inhibiting mitochondrial permeability transition pore opening at reperfusion protects against ischaemia-reperfusion injury Cardiovasc Res 2003 60 3 617 625 46 Yang CW, Ahn HJ, Han HJ, Kim WY, Li C, Shin MJ, et al. Pharmacological preconditioning with low-dose cyclosporine or FK506 reduces subsequent ischemia/reperfusion injury in rat kidney. Transplantation. 2001;72(11):1753-9. Yang CW Ahn HJ Han HJ Kim WY Li C Shin MJ Pharmacological preconditioning with low-dose cyclosporine or FK506 reduces subsequent ischemia/reperfusion injury in rat kidney Transplantation 2001 72 11 1753 1759 Artigos Originais Mistura de Ácido Gálico e Ciclosporina e seus Efeitos sobre a Disfunção Cardíaca Induzida pela Isquemia / Reperfusão e Expressão de eNOS/iNOS Badavi Mohammad 1 2 4 Sadeghi Najmeh * 3 Dianat Mahin 1 4 Samarbafzadeh Alireza 4 Physiology Research Center, Department of Physiology, Ahvaz Jundishapur University of Medical Sciences Arteriosclerosis Research Center, Golestan Hospital, Ahvaz Jundishapur Department of Physiology, Faculty of Medicine, Jahrom University of Medical Sciences, Jahrom Infectious and Tropical Research Center, Department of virology, Faculty of Medicine, Ahvaz Jundishapur University of Medical Sciences, Ahvaz - Irã Correspondência: Najmeh Sadeghi, Department of Physiology, Faculty of Medicine, Jahrom University of Medical Sciences, Jahrom - Irã. E-mail: najmeh.sadeghi@gmail.com Autor correspondente

Contribuição dos autores

Concepção e desenho da pesquisa: Dianat M. Obtenção de dados: Sadeghi N. Análise e interpretação dos dados: Dianat M. Análise estatística: Sadeghi N. Obtenção de financiamento: Badavi M. Redação do manuscrito: Sadeghi N. Revisão crítica do manuscrito quanto ao conteúdo intelectual importante: Badavi M. Interpretation the gene bands: Samarbafzadeh A.

Potencial Conflito de Interesse

Declaro não haver conflito de interesses pertinentes.

 Resumo Fundamento:

Embora muitas pesquisas tenham sido conduzidas com um determinado antioxidante ou mPTP individualmente, pouca atenção tem sido dada para os efeitos da co-administração de um antioxidante e um inibidor de mPTP sobre a disfunção cardíaca após a lesão de I/R.

 Objetivos:

Este estudo objetiva determinar os efeitos do ácido gálico (como antioxidante) combinado com a ciclosporina A (CsA) (como inibidor de mPTP) na função cardíaca e endotelial na disfunção induzida por I/R (função de NO).

 Métodos:

Ratos Wistar machos foram pré-tratados com ácido gálico (7,5, 15 ou 30 mg.kg-1 de peso corporal, diariamente) por um período de 10 dias. Em seguida, o coração foi isolado e exposto a isquemia de 30 minutos e perfundido por CsA (0,2 µM) 20 min durante o período de reperfusão.

 Resultados:

Os dados mostraram que o tamanho do infarto foi significativamente diminuído por CsA e ácido gálico sozinho (p < 0,05, ANOVA unidirecional seguido de teste LSD). A combinação de ambos os fármacos, entretanto, apresentou efeitos de melhora mais significativos (p < 0,001). A combinação destes dois fármacos melhorou mais significativamente a taxa máxima de aumento e de queda da pressão ventricular (± dp.dt-1 máx), o duplo produto (DP), a pressão ventricular esquerda desenvolvida (PVED), a frequência cardíaca e o fluxo coronário quando comparada à aplicação de apenas um deles (p < 0,05, medidas repetidas ANOVA seguidas de teste de LSD).

 Conclusões:

Em conclusão, o benefício de um antioxidante concomitante com um inibidor da mPTP poderia ter efeitos mais benéficos sobre a disfunção cardíaca induzida pela lesão I/R.

 Palavras-chave: Antioxidantes Ácido Gálico Ciclosporina Função Ventricular Endotélio Isquemia Reperfusão Ratos Óxido Nítrico Sintase Introdução

O fornecimento interrompido de oxigênio acompanhado por isquemia miocárdica leva ao declínio mitocondrial no fluxo da cadeia transportadora de elétrons (CTE) cujo o resultado é o subsequente inchaço e degeneração mitocondrial. Nesse caso o ATP está esgotado, de modo que abre-se o caminho para a necrose e morte mitocondrial com o início da permeabilidade mitocondial com a abertura dos poros de transição de permeabilidade mitocondrial (mPTP).1-3

O conceito de lesão de células miocárdicas que ocorrem após uma isquemia / reperfusão (I/R) envolve duas hipóteses principais: aumento do cálcio intracelular e / ou acúmulo de espécies reativas de oxigênio (ERO). Este último causando a peroxidação sarcolemal da camada de fosfolipídio celular, que leva à perda da integridade celular e facilita a entrada de cálcio. Durante uma reperfusão, o cálcio entra na mitocôndria como reação a uma variedade de estímulos e pode modular a abertura do mPTP com os seus componentes acessórios.2,4

O NO é um importante modulador do tonus vascular. Danos funcionais no endotélio devido à formação de peroxinitrito são o resultado da combinação de ERO com NO. Este composto tóxico pode resultar no início da morte celular apoptótica.5 Estudos anteriores revelaram que o extrato de vinho tinto e tratamento antioxidante melhoraram significativamente a função pós-isquêmica ventricular e contrátil.6,7 Para reduzir a lesão letal de reperfusão, novas estratégias cardioprotetoras, incluindo o pré-condicionamento com antioxidantes e inibidores da mPTP,8 têm sido aplicados. Um dos mecanismos fundamentais envolvendo a abertura dos canais de K+ sensíveis ao ATP (K+ATP) nas mitocôndrias resulta no bloqueio do colapso induzido pela isquemia da mPTP e, assim, leva à preservação da função mitocondrial e ATP celular.8,9

Estudos anteriores demonstraram que o ácido gálico, um metabólito do propil galato, melhora o status antioxidante e protege o coração e a membrana dos lisossomos contra o estresse oxidativo induzido pelo isoproterenol em ratos.10 Além disso, a perfusão de polifenol (-) - epigalocatequina galato (EGCG) durante a isquemia reduziu significativamente o tamanho do infarto (50%) após a reperfusão. Deve-se notar que os canais mitocondriais de K+ATP desempenharam um papel crucial na cardioproteção induzida pelo EGCG.11 O tratamento com ácido gálico, mostrado em Ananya (2012), melhorou a cicatrização da úlcera aumentando a razão e-NOS / i-NOS.12 Em outro estudo, o ácido gálico induziu a expressão de eNOS e modulou a vasodilatação e a vasoconstrição dependentes do endotélio.13 A eNOS com papel anti-inflamatório poderia proteger a célula contra lesões I/R através do aumento da produção de NO.13

No entanto, levantamento da literatura mostrou que não há relatos científicos disponíveis sobre os efeitos antioxidantes do ácido gálico sobre os parâmetros hemodinâmicos ou expressão NOS após a lesão I/R.

Além disso, descobriu-se que a inibição da mPTP pela ciclosporina A preservou a morfologia mitocondrial após isquemia/reperfusão miocárdica, limitou a necrose e a apoptose miocitárias e reduziu o tamanho do infarto (60%).14

De acordo com os factos descritos, a abertura da mPTP induzida pelo stress oxidativo desempenha um papel crucial na lesão letal de perfusão que é uma pedra angular na cardioprotecção. O principal objetivo deste estudo foi, portanto, investigar o efeito da combinação de ácido gálico como um poderoso antioxidante e da ciclosporina A como inibidor de mPTP na disfunção hemodinâmica cardíaca, no tamanho do infarto e na expressão de NOS após isquemia/reperfusão no coração isolado de ratos.

 Material e Métodos

Aprovação ética

Os protocolos e procedimentos do presente estudo foram aprovados pelo comitê de utilização e cuidado de animais da Ahvaz Jundishapur University of Medical Sciences (AJUMS.REC.1392.222).

Animais

Os experimentos foram conduzidos em noventa ratos machos Wistar pesando (250-300 g) obtidos de casa de animais da Universidade de Ciências Médicas Ahvaz Jundishapur, Ahwaz, Irã. Os animais foram divididos aleatoriamente nos seguintes 9 grupos (Tabela 1). Em cada grupo foram escolhidos 10 ratos utilizando a fórmula de Cochran. Diferentes doses de ácido gálico foram dissolvidas em soro fisiológico e administradas uma vez por dia durante 10 dias por via oral através de uma agulha de gavagem.10 Todos os grupos foram mantidos sob as mesmas condições (temperatura controlada 22 ± 2ºC, com um ciclo de luz escura de 12 h fornecido com alimento e água ad libitum).

Grupos de animais que foram utilizados neste estudo (n = 10)
Grupos1 Ácido gálico (mg/kg) Ciclosporina (µM)
Placebo2
C1 CaCb SalinaSalina 00,2
G1 G1aG1b 7,57,5 00,2
G2 G2aG2b 1515 00,2
G3 G3aG3b 3030 00,2

C: grupos de controle; G: grupos que receberam ácido gálico. Esse grupo não foi exposto a isquemia/reperfusão.

Escolhemos o tamanho da amostra usando a fórmula de Cochran. Com o uso do número de ratos em cada grupo foi____. Mas nós previmos alguns desaparecidos por causa da isquemia. Então, selecionamos 10 ratos em cada grupo.

A fórmula de Cochran foi:

n = Z a 2 2 S 2 d 2

Drogas

Ácido gálico, ciclosporina A (CsA), heparina, cloreto de 2,3,5-trifenil tetrazólio (TTC), foram adquiridos da Sigma (St. Louis, MO); cloreto de sódio, cloreto de potássio, sulfato de magnésio, hidrogenocarbonato de sódio, hidrogeno-ortofosfato de potássio, D-glicose e cloreto de cálcio foram obtidos de Merck Laboratories, cetamina e xilazina de Alfasan Co (Woderen-Holland).

 Isolamento e preparação do coração

Os animais foram anestesiados com Ketamina HCL (50 mg.kg-1), xilazina (2-5 mg.kg-1) e para prevenir a coagulação sanguínea foi injetada heparina (1000 U.kg-1, IP). A traquéia foi canulada e os animais foram ventilados com ar ambiente utilizando um ventilador de roedores (UGO BASILE, modelo: 7025).15 O peito foi aberto e as costelas foram removidas e, em seguida, uma cânula de aço foi colocado na aorta e firmada com uma sutura. O coração foi imediatamente perfundido com solução de Krebs-Henseleit. Em seguida, o coração foi rapidamente excisado e transferido para um aparelho de Langendorff enquanto era continuamente perfundido com a solução a uma pressão (60-70 mmHg) e temperatura (37º constantes (60-70 mmHg) (37°C). Antes de iniciar as experiências, o tampão foi borbulhado com O2-5% de CO2 a 95% para se obter um pH de 7,4.

Um balão de látex cheio de água que foi ligado a um transdutor de pressão por uma agulha de aço inoxidável que foi introduzida através do átrio esquerdo no ventrículo esquerdo para medir a pressão ventricular esquerda (PVE). O coração foi colocado numa câmara de vidro revestida a 37°C de temperatura e abastecido com um período de 25 a 30 min para atingir o equilíbrio antes de qualquer experimento. O volume do balão foi ajustado de forma que a pressão diastólica final do VE (PDF) atingisse 5-10 mmHg.

Utilizou-se um sistema de alimentação de força (Power lab, AD instrument, Australia) para analisar o sinal do transdutor de pressão. A pressão ventricular esquerda desenvolvida (PVED), pressão sistólica ventricular esquerda (PDVE), PDF ventricular, taxa máxima de aumento (+ dp.dt-1 max) e taxa máxima de queda (-dp.dt-1 max) de PVE e o produto de taxa de pressão (RPP, produto de PDVE e frequência cardíaca) e o ângulo II do ECG foram registados. Todos os corações foram perfundidos durante 25-30 min antes da indução de isquemia para permitir a estabilização da PVE e da Pressão de Perfusão Coronária (PPC). Em seguida, eles foram submetidos a uma isquemia global sem fluxo de 30 min, seguida de 60 min de reperfusão.16 A indução bem sucedida da isquemia foi determinada pela elevação do ST no eletrocardiograma. A frequência cardíaca e a pressão de perfusão foram constantemente monitoradas.15 A CsA foi dissolvida em etanol e adicionada a uma solução de perfusão. Após 30 min de isquemia, os corações foram reperfundidos com 0,2 µM de CsA durante 10 min e depois a reperfusão continuou com tampão de solução Krebs-Henseleit comum.17 Os parâmetros cardíacos acima mencionados foram medidos no final da isquemia e a cada 15 minutos durante o período de reperfusão.

 Determinação do tamanho do infarto

No final das experiências acima mencionadas, o coração foi cortado em fatias (2 mm de espessura) e incubado com TTC a 1% durante 20 minutos a 37°C de temperatura. Em seguida, as fatias foram incubadas em formalina a 10% durante 60 minutos. E depois, a área do infarto foi medida pelo cálculo da porcentagem da área total de fatia em ambos os lados através da utilização do software de análise de imagem (NIHimagepro.1.16).17

Avaliação da expressão de eNOS e mRNA

As amostras de tecido foram congeladas durante 1 mês. No dia da experimentação, o RNA total foi extraído das amostras de tecido congelado utilizando reagente Trizole (Roche Diagnostics, Indianapolis, IN). A concentração do RNA total foi determinada por espectrofotometria (Bio Photometer Plus, Eppendorf, Hamburgo, Alemanha). Lemos o RNA a 230 e 260 nm. As amostras que estavam em 1,9-2,1 mm foram selecionadas para continuar a avaliação. As outras foram excluídos do estudo.

O cDNA, de acordo com as instruções do fabricante, foi sintetizado a partir de 1 µg do RNA total com o kit Reverse Transcription (Fermentase, Inglaterra).

Foi realizada a transição reversa e reação na cadeia da polimerase (RT-PCR) para determinar os níveis de RNAm (endotelial) (eNOS) das isoformas constituintes e indutíveis da sintase do óxido nítrico (iNOS) no tecido ventricular dos ratos.18

Amplificação de PCR

A solução de PCR continha 10 µl de cADN monocatenário, 5 µl de buffer de PCR 10X, 10 mM MgCl2, 25 Pico mol de ambos sentidos (5_-ACC ACA GTC CAT GCC ATC AC-3_) e antisentido (5_-TCC ACC ACC CTG TTG CTG TA - 3_) primer GAPDH.19 Proporcionou 400 pb de GAPDH, 25 pico mol de ambos sentidos (5_-CGA GAT ATC TTC AGT CCC AAG C-3_) e antisentido (5_-GTG GAT TTG CTG CTC TCT AGG-3_) eNOS primer,19 que produziu 200 pb de eNOS, e 25 Pico mol de sentido (5`CACCTTGGAGTTCACCCAGT3) e antisentido (5 'ACCACTCGTACTTGGGATGC3) iNOS primer,20 que produziu 220 pb de iNOS mensagem, 5U/µl Termophylus Acquaticus (Taq) ADN polimerase (Cinagen, Irán, ) e água até um volume final de 50 µl.

O programa de ciclagem consistiu de incubação a 95°C durante 3 min (eNOS e GAPDH) e a 94°C durante 45s para (iNOS) para ativar a Taq DNA polimerase e 35 ciclos de dois passos com desnaturação a 60°C durante 60s (eNOS e GAPDH) e 60°C para 45s (iNOS) e recozimento/extensão a 72°C por 10 min para todos eles. O modelo de controle negativo (H2O) foi rotineiramente executado em cada PCR. Os produtos de PCR foram executados em electroforese em gel de agarose a 2% e fotografados após coloração com brometo de etídio sob UVlight. Os níveis de expressão de todos os genes foram normalizados contra a expressão de GAPDH (calibrador interno para carga e normalização de molde de RNA iguais). Utilizando um sistema densitométrico computadorizado (Imagem J),18 as bandas no gel foram digitalizadas e quantificadas.

 Análise estatística

Os resultados foram analisados utilizando SPSS versão 16 e expressos como Média ± SEM. As comparações entre os grupos foram realizadas utilizando ANOVA de uma via ou ANOVA de medição repetida seguida por teste de comparação múltipla de LSD. Valores de P inferiores a 0,05 foram considerados significativos. A normalidade foi verificada utilizando o teste de Kolmogorov Smirnov. Foram analisadas as alterações hemodinâmicas entre o grupo de controle e outros durante as 2 horas de teste. Este período incluiu o período pré isquemia, isquemia e reperfusão. Durante este tempo registramos as alterações repetidamente. O objetivo principal foi comparar essas alterações entre os grupos controle e tratados. Assim, a comparação dentro de cada grupo não foi realizada.

 Resultados Efeitos do ácido gálico + CsA sobre a função miocárdica

A contratilidade miocárdica (mostrada como ± dp.dt-1) foi diminuída em quase todos os grupos, como mostrado na Tabela 2. Embora o pré-tratamento com ácido gálico (7,5-30 mg.kg-1) sozinho não tenha tido efeitos significativos, a CsA melhorou a contractilidade significativamente comparado com o controle (p < 0,01). No entanto, a combinação de ácido gálico (15 mg.kg-1) e CsA apresentou efeitos de melhora mais significativos na contratilidade (p < 0,001). Também a forma combinada melhorou a contractilidade em comparação com a CsA apenas (p < 0,05) e não teve efeito significativo com ácido gálico sozinho.

Parâmetro hemodinâmicos durante os períodos de pré-isquemia e reperfusão (60 min após isquemia) do protocolo de isquemia-reperfusão
Grupo1 +dp/dt -dp/dt PDVE PSVE DP FC FrC
Controle Pré 2 991,2±384 1 615,5±237,5 90±15,1 95.5±15.2 27 989,5±5 499,9 11,2±1 273,7±12,6
Pós 605,6±72,3 291,7±37,4 22,9±2,9 33.3±5.3 4 319,2±394 4,1±0,5 171,2±15,6
G 7,5 Pré 2 342,7±278,9 1 067,4±152,4 68,4±9,1 74±9,1 18 084,8±3 672,1 11,8±1,1 236±10,5
Pós 1 358,3±546,9 504,2±215,6 41,2±14,3 59,5±11,5 8 970,4±3 516,9 6,2±1,5 200,8±21,9
G 15 Pré 2 801,2±312,6 1 242,7±131,5 67,3±5,1 74,2±5,2 19 349,7±1 273,5 11,7±0,8 281,3±9,1
Pós 820,5±134 321,7±59,6 25,2±3,4 37,5±4,2 3 934,6±903,7 5,4±1 152,8±18,3
G 30 Pré 2 367,3±210,8 1 507,9±568,7 64,4±7,9 71,9±7,8 18 409,3±2 323,4 10,3±1 257,7±13,3
Pós 840±141,4 306,9±56,3 39±8,3 51,8±7 6 271,9±2 153,9 5±0,6 151,6±24
CsA Pré 3 036,4±374,5 1 470,2±236,2 82,1±10,2 88,1±9,9 23 409,6±2 442,3 10,4±1,2 292±14
Pós 1 510±319,9** 670±142,1 36,3±7,6 53,5±7,1 8 881±1 623,9 7,6±0.9*(p=0,006) 210,9±19,1
G 7,5+ CsA Pré 2 477,9±192,7 1 165,6±168,6 66,6±5 72,1±5,7 15 614,3±1 681,6 10,4±1,1 234±16,6
Pós 1 016,6±225,9 402,8±128,8 63,8±7**(p=0,003) 73,8±20,1*(p=0,01) 11 486,5±5 450,9*(p=0,02) 5,3±1,3 193,9±19,6
G 15+ CsA Pré 2 764,9±208 1 614,4±213,5 89,1±13 94±12 23 173,8±3 674,2 10,7±1,2 243,6±9,2
Pós 2 142,1±314,9**, #(p=0,007) 841,4±109,5*,#(p=0,03) 54,1±8,3**(p=0,007) 88,8±10,3**(p=0,002) 10 063±1 601,6**(p=0,001) 7,7±1,9**(p=0,007) 187±17,2
G 30+ CsA Pré 2 554,4±180 1 164,4±123,9 72,5±7 78,9±7,2 20 498±2 285,7 8,6±1 283,2±17,7
Pós 911,3±198,2 327,6±77,4 22,6±4,4 35,8±6,1 4 462±1 050,4 6,5±1,5 186,8±24

Controle: grupo de controle, G7,5: ácido gálico (7,5 mg / kg), G15: ácido gálico (15 mg / kg), G30: ácido gálico (30 mg / kg) CsA: ciclosporina A, G7,5 + CsA (ácido gálico (7,5 mg / kg) + CsA), G15 + CsA (ácido gálico (15 mg / kg) + CsA), G30 + CsA (ácido gálico (30 mg / kg) + dp / dt: Taxa máxima de aumento da pressão do ventrículo esquerdo, - dp / dt: taxa mínima de aumento da pressão ventricular esquerda, PDVE: pressão desenvolvida ventricular esquerda; PD: produto duplo; FC: fluxo coronariano; FrC: frequência cardíaca; Pre: pré isquemia; post: pós-isquemia.

p < 0,05: em comparação com controle,

p < 0,01: em comparação com controle,

*** p < 0,001: em comparação com controle.

Comparado com CsA sozinho.

Além disso, doses diferentes de ácido gálico ou CsA isoladamente não tiveram efeitos significativos no PDVE, enquanto a administração de ácido gálico (7,5 e 15 mg.kg-1) + CsA melhorou PDVE significativamente (p < 0,05, Tabela 2). O PSVE foi aumentado pelo pré-tratamento de ácido gálico (7,5 e 15 mg.kg-1) em combinação com CsA (p < 0,05); Mas o efeito combinado de 15 mg.kg-1 de ácido gálico + CsA foi mais significativo do que o de pré-tratamento com ácido gálico (7,5 mg.kg-1) + CsA em comparação com o controle (p < 0,01, Tabela 2). Este aumento não foi significativo em comparação com CsA ou gálico sozinho.

O produto de pressão de taxa (RPP) foi diminuído em quase todos os grupos, como mostrado na Tabela 2. Embora o pré-tratamento com ácido gálico (7,5-30 mg.kg -1) sozinho não tenha tido efeitos significativos no PD, a combinação de ácido gálico (15 + CsA mg.kg -1) e CsA melhorou significativamente em comparação com o controle (p < 0,001 ). Neste caso, a comparação de combinações tratamento com CsA ou gálico sozinha não foi significativa.

 Fluxo coronário

O fluxo coronariano diminuiu em todos os grupos durante a reperfusão pós-isquêmica em comparação com a pré-isquemia. A administração de ácido gálico (15mg.kg-1) + CsA e CsA melhorou o fluxo coronariano significativamente para o valor pré-isquêmico normal comparado com o controle (Tabela 2). Contudo, outras doses de ácido gálico sozinhas ou numa forma combinada não tiveram efeitos significativos no fluxo coronário em comparação com o controle ou a CsA sozinha. Também o ácido gálico sozinho não teve efeito significativo em comparação com a sua forma combinada.

 Frequência cardíaca

No início do experimento, a frequência do coração isolado em todos os grupos não foi diferente entre si (período pré isquemia). No entanto, no final da reperfusão, a frequência cardíaca de todos os grupos foi significativamente reduzida em comparação com o controle (p < 0,05, Tabela 2), mas esta redução não foi significativa em comparação com CsA ou ácido gálico isolado. No entanto, a administração de CsA sozinha aumentou ligeiramente a frequência cardíaca durante os primeiros 60 minutos de reperfusão.

 Efeitos do ácido gálico + CsA no tamanho do infarto do miocárdio

O tamanho do infarto do miocárdio foi expresso como a razão percentual da área do infarto para a área total. Esta razão foi de 26,74 ± 2,35% para o grupo controle submetido a 30 min de isquemia e 1h de reperfusão (Figura 1). Apesar do fato de que houve uma redução significativa no tamanho do infarto para aqueles grupos que receberam ácido gálico 15,30mg.kg -1 ou CsA sozinho (p < 0,05, ANOVA unidirecional seguido de LSD), essa redução para esses grupos recebendo ácido gálico (15 ou 30 mg.kg -1 doses) + CsA foi muito mais significativo em relação ao controle (p < 0,001, uma via ANOVA seguida de LSD). Não houve diminuição significativa entre a forma combinada em comparação com CsA ou ácido gálico sozinho.

Efeitos do ácido gálico e/ou ciclosporina A (CsA) no tamanho do infarto do miocárdio (média ± SEM, n = 10) de diferentes grupos de ratos.

Os animais receberam três doses diferentes de ácido gálico (7,5, 15 e 30 mg / kg) durante 10 dias antes do isolamento do coração e indução de isquemia (30 min) e reperfusão (1 h) sem ou com CsA (0,2 µM, 10 min antes e durante a reperfusão). Os animais de controle receberam solução salina normal como solvente de ácido gálico. O tamanho do infarto do miocárdio é expresso como a relação entre a área do infarto e a área de risco total em percentagem. * Indica diferença significativa com o grupo de controle (* p < 0,05, *** p < 0,001, n = 10 por grupo uma ANOVA seguida pelo teste LSD).

 Efeitos do ácido gálico e ciclosporina na expressões eNOS e iNOS mRNA

A análise dos resultados de PCR revelou que a isquemia / reperfusão diminuiu os níveis de expressão de RNAm de eNOS no grupo de controle em comparação com ratos placebo operados, mas a expressão de RNAm de iNOS aumentou no grupo de controle em comparação com sham. Os níveis de RNAm de eNOS foram significativamente aumentados em animais tratados com ácido gálico (G7,5, G15 e G30 mg / kg) ou tratados com CsA (0,2 µM) sozinhos, em comparação com o grupo de controle (p < 0,001; ). Os níveis mais elevados de expressão de mRNA de eNOS foram observados na administração de ácido gálico concomitante e CsA em comparação com controle. (p < 0,001, Figura 2a). A elevação da expressão de RNAm não foi significativa em comparação com CsA ou gálico sozinha.

A expressão de RNAm de iNOS diminuiu significativamente usando ácido gálico (G15 e G30 mg /kg) ou CsA sozinha comparada com a do grupo de controle, contudo a combinação de ambos os fármacos induziu mais redução com doses mais baixas de ácido gálico (G7,5 + CsA, G15 + CsA) (p < 0,001, Figura 2b) e figura suplementar. As alterações mencionadas não foram significativas em comparação com CsA ou gálico isoladamente.

Efeitos do ácido gálico e da ciclosporina nas expressões (a) eNOS e (b) iNOS.

Expressão RNAm.

Os dados foram expressos como a média ± SEM. Os animais receberam três doses diferentes de ácido gálico (7,5, 15 e 30 mg.kg-1) durante 10 dias antes do isolamento do coração e indução de isquemia (30 min) e reperfusão (1 h) sem ou com CsA (0,2 µM, 10 min antes e durante a reperfusão). A análise de resultados de PCR quantitativos revelou que a administração de ácido gálico reduziu a expressão de mRNA de iNOS mas aumentou a de eNOS.

Os dados foram expressos como a média ± SEM. Os animais receberam três doses diferentes de ácido gálico (7,5, 15 e 30 mg.kg-1) durante 10 dias antes do isolamento do coração e indução de isquemia (30 min) e reperfusão (1 h) sem ou com CsA (0,2 µM, 10 min antes e durante a reperfusão). A análise de resultados de PCR quantitativos revelou que a administração de ácido gálico reduziu a expressão de mRNA de iNOS mas aumentou a de eNOS.

Para a descrição de grupos experimentais, veja a legenda da Fig. 2a, e b. Os asteriscos indicam uma diferença significativa. *** p < 0,001 em comparação com o grupo de controle (n = 6).

 Discussão

Como esperado, as funções cardíacas tais como contractilidade, DP, fluxo coronariano e PDVE reduziram durante isquemia e reperfusão. Os resultados deste estudo mostraram que embora o pré-tratamento de animais com ácido gálico sozinho, como antioxidante, tenha reduzido o tamanho do infarto, não teve efeitos significativos sobre as funções cardíacas. Além disso, a reperfusão do coração com CsA melhorou parcialmente as funções cardíacas e reduziu o tamanho do infarto. No entanto, a combinação de ambos os fármacos teve efeitos mais significativos no desempenho cardíaco e na redução do tamanho do infarto.

O quarto objeto foi medir o tamanho do infarto. Outros estudos mostraram que este parâmetro aumentou após 3 horas de reperfusão em comparação com 1 hora21 com coloração com TTC. Assim, nós o avaliamos após 1 hora de reperfusão de acordo com os nossos principais objetos de estudo (investigação das alterações durante o início da reperfusão não depois).

Sob condições normais, há um equilíbrio entre a formação de pró-oxidantes e a quantidade de antioxidantes. Durante a I/R, o comprometimento da função miocárdica é atribuído principalmente à interrupção do referido equilíbrio e à elevação da produção de ERO.22 Foi demonstrado que o excesso de ERO poderia levar à formação de peroxinitrito a partir de radicais NO em resposta à sua combinação com ânion superóxido e danificar as células dos tecidos vascular e cardíaco.23 Além disso, a peroxidação lipídica da membrana celular exacerba a depleção da energia celular devido ao dano das enzimas mitocondriais. Além disso, os ácidos nucleicos, a integridade da membrana celular, o retículo sarcoplasmático (SR) e a função de permutador Na + -Ca2 + são danificados, de modo que ocorrem sobrecargas Ca2 + intracelulares e mitocondriais.24 Após estes eventos, o excesso de Ca2 + induz a disfunção das enzimas mitocondriais, despolarização da membrana e abre a mPTP nos miócitos cardíacos.2 Durante a isquemia, devido à interrupção da cadeia de transporte de elétrons (ETC), a produção de ATP é prejudicada e a célula é esgotada de fosfatos de alta energia.25 Após estas lesões, devido ao metabolismo anaeróbio e ao acúmulo de lactato e piruvato, a acidose intracelular é aumentada, e então ocorre o desacoplamento da fosforilação oxidativa que, por sua vez, leva ao inchaço mitocondrial. Este ciclo vicioso leva à morte celular necrótica e disfunção cardíaca.26 Após a abertura da mPTP, o citocromo C é libertado dentro do citosol, interage com o factor 1 de activação da protease da apoptose (APAF-1) e conduz à activação da caspase-9 que activa a caspase 3 que é a chave executora para a sinalização apoptótica.27

Durante os últimos anos, algumas estratégias de proteção cardiovascular foram aplicadas para reduzir as lesões letais de I/R, incluindo pré e pós-condicionamento por antioxidantes, por ativadores da via de quinase de salvamento de lesão por reperfusão (RISK), pela inibição de proteína quinase c-delta e, finalmente, por inibidores de mPTP tais como CsA ou sanglifehrina A.28 Neste estudo, nossa estratégia foi proteger o coração usando antioxidante e impedir a abertura da mPTP. Por meio desta hipótese, a hipótese de que a célula pode ser isolada contra o anteriormente mencionado ciclo vicioso que leva à abertura de mPTP e, em seguida, para a interrupção da produção de ATP.26

Estudos anteriores demonstraram que o ácido gálico poderia melhorar o estado antioxidante através da inibição da peroxidação lipídica e que protege a membrana do coração e do lisossomo contra o estresse oxidativo induzido pelo isoproterenol em ratos.29 Além disso, durante a I/R, a administração de polifenol (-) - epigalocatequina galato (EGCG) reduziu significativamente o tamanho do infarto em 50% e os canais mitocondriais KATP desempenharam um papel crucial na proteção cardio induzida por EGCG.30 Além disso, EGCG inibe a transcrição da óxido nítrico sintase induzível.31 Por outro lado, foi relatado que a inibição da mPTP por CsA manteve a morfologia mitocondrial após a lesão I/R em coelhos e que limitou a necrose miocitária e a apoptose.32

Demonstrou-se que a reperfusão teve alguns efeitos prejudiciais devido à produção de ERO e desordens de PH durante o período de isquemia. Esse fenômeno é dependente do tempo e pode levar à morte celular e lesão miocárdica, que é chamada de "lesão de reperfusão letal".8 Neste estudo, tivemos vários propósitos. O primeiro de nossos objetivos foi investigar a expressão de eNOS durante o tempo inicial de reperfusão. Também outros estudos sugeriram que a expressão de eNOS aumentou dependendo do tempo durante o início da reperfusão (1 hora) e a expressão de iNOS no final dela (3-24 h). Este aumento tem alguns efeitos prejudiciais via produção de NO. O NO reage com os ERO que foram produzidos durante a isquemia e formaram uma grande quantidade de ONOO- que foi levada à apoptose celular.33 A NO tem efeitos bidirecionais: valores moderados têm efeitos protetores, mas um nível alto é prejudicial. O segundo objetivo foi encontrar um dos mecanismos de como os antioxidantes podem melhorar a disfunção hemodinâmica e endotelial através da produção de NO e sua fonte durante a reperfusão precoce (via eNOS protetora).34 Assim, selecionamos uma hora de reperfusão que está relacionada à atividade da eNOS. Terceiro: medimos a atividade enzimática para avaliação de estresse oxidativo e lesão celular por infarto do miocárdio no período de reperfusão imediata, período em que está tipicamente em seu máximo35 e publicamos o resultado, sendo que a maior variação ocorreu durante os primeiros 15 minutos de reperfusão36 e por isso medimos esses parâmetros a cada 15 min como em outros métodos de estudo35 porque a lesão I/R foi agravada pelo tempo e nosso objetivo foi investigar o papel preventivo do inibidor antioxidante ou mPTP e o efeito combinado de ambos durante o tempo total da experiência. Íamos verificar a gravidade da lesão I/R após 60 min de reperfusão quando a produção de NO derivada de eNOS foi afetada pelo pré-tratamento com diferentes doses de antioxidante37,38 sozinho ou combinado com um inibidor de mPTP (CsA). Porque outros estudos mostraram que a inibição da transição de permeabilidade mitocondrial com esta droga pode impedir a expressão de eNOS.39 Concluímos que nosso antioxidante (ácido gálico) modulou a lesão I/R através da produção de NO e este NO foi derivado de eNOS não iNOS. A investigação das alterações hemodinâmicas durante a reperfusão tardia não foi o principal objetivo do nosso estudo.

Apesar de ter observado que o fluxo aumentou de forma insignificante durante a reperfusão nos corações de animais pré-tratados apenas com ácido gálico, concluímos que a sua combinação com CsA teve efeitos mais significativos. A melhora acima mencionada na função cardíaca, observada em nosso estudo, pode ser atribuída aos efeitos antioxidantes do ácido gálico. Parece que o vasculhamento de ERO por ácido gálico já relatado10 poderia proteger as células contra o estresse oxidativo e nitosativo. Além disso, por inibição da produção de nitrito proxy, poderia manter a função do endotélio e o tônus vascular. Estudos anteriores mostraram que o ácido gálico aumentou a expressão da eNOS2. Um aumento na atividade de iNOS e uma diminuição na atividade de eNOS durante a isquemia foram relacionados a lesões de I/R. Nossos resultados mostraram que a expressão de iNOS pós-isquemia no grupo de controle aumentou para 1,6 vezes a do grupo de placebo. O tratamento com ácido gálico ou CsA sozinho elevou a razão original de eNOS / iNOS 2 vezes, mas a combinação de ambos os fármacos foi mais eficiente. É porque a expressão de eNOS dobrou três vezes, usando ácido gálico com CsA, mas a expressão de iNOS foi reduzida para um quarto. Estes resultados correspondem aos de outros pesquisadores que sugeriram o aumento da razão eNOS/iNOS com um análogo do resveratrol.40 Em conjunto, nossos resultados estabeleceram que o NO derivado da eNOS provavelmente modulou o fluxo sanguíneo e este efeito é mais eficiente na combinação de ácido gálico 15 mg / Kg com CsA. Além disso, a expressão de eNOS aumentada pelo uso de todos os compostos poderia ser atribuída a uma maior biodisponibilidade de NO durante a lesão I/R.41 Além disso, nossos resultados revelaram que a contratilidade (±dp.dt-1), RPP, PDVE e frequência cardíaca foram melhoradas nos grupos perfundidos por CsA em combinação com pré-tratamento com ácido gálico. Este efeito pode ser atribuído à preservação da mitocôndria contra ERO, aumentando a capacidade antioxidante com ácido gálico e através da inibição da abertura mPTP por CsA. Assim, o ATP poderia ser mantido na célula e a sobrecarga de Ca2+ foi impedida devido à captação aumentada de Ca2+ para a SR pela ativação da via RISK. Portanto, a interação de elementos contráteis entre si poderia ser melhorada e tornar-se mais rápida.42 No entanto, a utilização da dose mais elevada de ácido gálico (30 mg/kg) inverteu estes efeitos. De acordo com outro estudo, o processo poderia ser explicado por um efeito pró-oxidante do ácido gálico em altas doses, porque provou que o íon férrico poderia quelar o grupo hidroxila na molécula de ácido gálico e reduzir o potencial de oxidação e desse modo perder sua atividade antioxidante.43 Além disso, a contratilidade foi aumentada com CsA sozinha, mas não se recuperou com G7,5+ CsA. Este efeito pode ser explicado com lesões I/R após 1 hora de reperfusão. Porque na reperfusão de 1 hora, a contratilidade diminuiu muito mais do que a reperfusão de 30 minutos, de modo que a lesão se agravou e o efeito protetor da CsA não conseguiu recuperá-lo ao nível de reperfusão de 30 minutos. Por outro lado, ao usar doses mais altas de Gálico (G15+ CsA), o sistema antioxidante fica mais forte e previne a produção de ERO na mitocôndria.26 De fato, é possível que a CsA não possa inibir mais mPTP que foi aberto por ERO produzido devido a lesões de I/R ao longo do tempo.

Alguns dos estudos controlaram a frequência cardíaca com marca-passo. Também esta foi uma variável em nosso estudo. Nós íamos avaliar suas mudanças durante o experimento, então não a controlamos. Devido à comparação dessa variável com o grupo controle, não foi possível fazer um viés neste estudo (todos os grupos foram semelhantes). O objetivo deste trabalho foi investigar as variações dos parâmetros hemodinâmicos afetados pela I/R e pré - tratamento. Assim sendo, a frequência cardíaca foi uma variável que quisemos avaliar por si mesma, sem qualquer intervenção (O uso do marcapasso não satisfez este objetivo). Existem outros estudos que utilizam este método.35

Outros estudos mostraram que o tamanho do infarto aumentou após a reperfusão21 com coloração TTC. Assim, nós o avaliamos durante o início da reperfusão.

Neste estudo, o tamanho do infarto foi significativamente reduzido pelo ácido gálico ou CsA sozinhos (quase 15%), mas esta redução foi mais significativa pela administração concomitante destes dois fármacos (quase 25%). Este efeito pode ser atribuído à ativação de um grupo de proteínas quinases que melhorou a desacoplamento da fosforilação oxidativa e impediu o inchaço das mitocôndrias e a morte celular.44 A inibição de mPTP provocou a ativação das vias antiapoptóticas e RISK e representou um mecanismo de sobrevivência celular programada. Também observamos que a administração de ambos os fármacos melhorou a contratilidade miocárdica mais do que a administração de cada fármaco sozinho.

Já foi reconhecido que a CsA não é apenas um inibidor de mPTP. Também inibe a calcineurina que modula a morte mitocondrial. Enquanto outros estudos relataram que a utilização de FK506, um potente inibidor de calcineurina que é 100 vezes mais potente do que CsA, não afectou a ativação da caspase. Portanto, o papel da CsA no bloqueio dos poros mitocondriais pode ser mais importante do que seus outros papéis. Além disso, outros estudos relataram que o uso de CsA em doses baixas não tem efeitos tóxicos.45 Utilizamos a dose mais baixa de (0,2 µM), muito inferior à de (20 mg.kg-1) utilizada por outros estudos,46 mas pode ser insuficiente para inibir o maior número de mPTP. Por conseguinte, o efeito de doses mais elevadas do inibidor de mPTP que até agora não foi explorado é altamente responsável por aguçar o interesse de investigadores e pesquisadores especializados em estabelecer uma investigação mais minuciosa.

 Conclusão

Em conclusão, o uso de ácido gálico como antioxidante concomitante com a preservação da mitocôndria por CsA como inibidor de mPTP em G15 + CsA em comparação com o controle, poderia ter efeitos mais benéficos sobre a disfunção cardíaca, expressões iNOS e NOS endotelial induzidas por lesão I/R .

 Limitações do estudo

Tivemos algumas limitações em nosso estudo, por exemplo, nosso financiamento e instalações foram muito limitados. Portanto não pudemos fazer mais experimentos. Por exemplo, não conseguimos fazer qPCR por causa dos recursos e limitação de instrumentos. Então, nos obrigamos a fazer as experiências usando as instalações que estavam disponíveis. Além disso, limitamo-nos a medir a expressão da proteína. Também tivemos limitações para a análise da função e morfologia mitocondriais.

 Aprovação ética

Os protocolos e procedimentos do presente estudo foram aprovados pelo comitê de cuidado e uso de animais da Universidade de Ciências Médicas Ahvaz Jundishapur (AJUMS.REC.1392.222).

Full texts in English - http://www.onlineijcs.org

Fontes de Financiamento

O presente estudo foi financiado por Research Affairs of Ahvaz Jundishapur University of Medical Sciences.

Vinculação Acadêmica

Este artigo é parte de tese de PhD de Najmeh Sadeghi pela Research Affairs of Ahvaz Jundishapur University of Medical Sciences.

 Agradecimentos

Esta pesquisa foi apoiada pela Research Affairs of Ahvaz Jundishapur University of Medical Science (concessão No. PRC 95) e foi uma parte da tese de PhD de Najmeh Sadeghi em fisiologia.

Agradeço a Sra. Khaghani, Maryam Rafiei e Kosar Bavarsad pela sua grande ajuda durante as minhas pesquisas.