Arq Bras Cardiol abc Arquivos Brasileiros de Cardiologia Arq. Bras. Cardiol. 0066-782X 1678-4170 Sociedade Brasileira de Cardiologia - SBC Nv9nQcBgRZTdV6dJyYxt7mj S0066-782X2025000700305 00305 10.36660/abc.20240885 Artigo Original A Orientina Alivia o Estresse Oxidativo e a Apoptose na Cardiomiopatia Diabética por Meio do Eixo Lncrna H19/Mir-103-3p/ALDH2/PI3K/AKT Wang Xun Concepção e desenho da pesquisa Obtenção de dados Análise e interpretação dos dados e Análise estatística Obtenção de financiamento Redação do manuscrito e Revisão crítica do manuscrito quanto ao conteúdo 1 Xiong Xiaofang Obtenção de dados Análise e interpretação dos dados e Análise estatística 1 Jiang Wei Análise e interpretação dos dados e Análise estatística 1 Xu Shanshan Análise e interpretação dos dados e Análise estatística 1 0009-0000-0796-357X Li Jun Análise e interpretação dos dados e Análise estatística Obtenção de financiamento Redação do manuscrito e Revisão crítica do manuscrito quanto ao conteúdo 1 Wuhan Third Hospital Wuhan China Wuhan Third Hospital, Wuhan - China : Jun Li • Wuhan Third Hospital, No.241 Pengliuyang Road, Wuchang District, Wuhan City, Hubei Province - China E-mail: lijundr77@hotmail.com

Marina Okoshi

Não há conflito com o presente artigo

 15 08 2025 07 2025 122 7 e20240885 11 01 2025 20 02 2025 16 04 2025 Este é um artigo de acesso aberto distribuído sob os termos da licença de atribuição pelo Creative Commons Resumo Fundamento

A cardiomiopatia diabética (CMD) é uma complicação cardiovascular irreversível do diabetes mellitus, caracterizada por remodelação cardíaca prejudicial. A orientina, um flavonoide hidrossolúvel presente em muitas plantas medicinais, exerce diversos efeitos farmacológicos.

 Objetivos

Investigar os efeitos cardioprotetores da orientina em condições diabéticas e elucidar os mecanismos associados aos RNAs não codificantes.

 Métodos

O modelo CMD induzido por estreptozotocina foi estabelecido pelo uso combinado de estreptozotocina e uma dieta rica em gordura. A estrutura e a função cardíaca em camundongos com diabetes mellitus foram avaliadas por meio de análises histológicas e ecocardiográficas. Masson, TUNEL, western blot e ELISA em corações de camundongos foram realizados para analisar fibrose cardíaca, apoptose e estresse oxidativo. Os níveis de expressão de lncRNA H19, miR-103-3p, ALDH2 e proteínas relacionadas a PI3K/AKT em células cardíacas de camundongos e HL-1 foram avaliados por qPCR em tempo real ou western blot. O nível de significância foi estabelecido em p<0,05.

 Resultados

A orientina melhorou a função cardíaca e amenizou a lesão cardíaca em camundongos diabéticos. A orientina inibiu a fibrose cardíaca, reduziu a apoptose dos cardiomiócitos e aumentou a atividade de enzimas antioxidantes. Em condições patológicas, os níveis de H19 e ALDH2 foram reduzidos, enquanto os níveis de miR-103-3p aumentaram, o que foi revertido pela orientina. A H19 aumentou a expressão de ALDH2 ligando-se a miR-103-3p e ativou a via PI3K/AKT em células HL-1 tratadas com altos níveis de glicose. A depleção de H19 ou o inibidor de PI3K reverteram os efeitos da orientina na apoptose e no estresse oxidativo em células HL-1 sob condições de altos níveis de glicose.

 Conclusões

Esses achados revelam um mecanismo protetor da orientina na CMD, que envolve a regulação do eixo de sinalização H19/miR-103-3p/ALDH2/PI3K/AKT, fornecendo uma estratégia potencial para o tratamento da CMD.

A Orientina Alivia o Estresse Oxidativo e a Apoptose na Cardiomiopatia Diabética por Meio do Eixo Lncrna H19/Mir-103-3p/ALDH2/PI3K/AKT

Cardiomiopatias Apoptose Estresse Oxidativo Wuhan Municipal Health Commision WZ241346 Fontes de financiamento: O presente estudo foi financiado por Wuhan Municipal Health Commision (WZ241346). Introdução

A diabetes mellitus (DM) é uma doença metabólica cuja prevalência continua a aumentar e é caracterizada por hiperglicemia resultante da secreção inadequada de insulina, resistência à insulina ou deficiência de glucagon. Hipersecreção.1 A cardiomiopatia diabética (CMD) é uma manifestação cardíaca do DM caracterizada por disfunção diastólica do ventrículo esquerdo e hipertrofia nos estágios iniciais,mais tarde por insuficiência cardíaca com função sistólica diminuída.2 Está bem estabelecido que as alterações estruturais e funcionais cardíacas em condições de CMD estão intimamente associadas ao estresse oxidativo persistente induzido por hiperglicemia, resultando emcardiomiócitomorte e disfunção cardíaca.3-5 Além disso, quando o coração está gravemente danificado, o excesso de colágeno leva à fibrose e disfunção cardíaca6 Até o momento, os mecanismos específicos associados à CMD são amplamente desconhecidos e não há tratamento eficaz para a doença. Portanto, é necessário identificar novos agentes ou alvos terapêuticos.

Os lncRNAs (long non-coding RNAs) desempenham funções regulatórias importantes em diversos processos e doenças celulares.7 Os microRNAs (miRNAs) participam das funções regulatórias de diversas atividades fisiológicas.8 Estudos sugerem que expressões anormais de ncRNAs estão envolvidas na progressão de doenças humanas, incluindo a CMD.9-11 Evidências também indicam que o tratamento com medicamentos (como a metformina) para DM pode alterar a expressão de ncRNA,12 sugerindo que a modulação da expressão de ncRNA pode ser um mecanismo importante no tratamento do DM. O LncRNA H19 participa dos processos regulatórios do metabolismo da glicose, metástase tumoral, diferenciação muscular, etc.13 O H19 foi identificado como uma molécula crucial em doenças cardíacas, pois pode regular a CMD,14 a hipertrofia cardíaca15 e a fibrose.16 A aldeído desidrogenase 2 (ALDH2) desempenha um papel fundamental na função respiratória mitocondrial e na remodelação da função ventricular.17,18 Além disso, o ALDH2 alivia a lesão isquêmica na CMD por meio da ativação da via PI3K/AKT.19 Nossos experimentos preliminares mostraram que o H19 pode aumentar a expressão de ALDH2 em cardiomiócitos de camundongos. Utilizando ferramentas online, identificamos o miR-103-3p como uma molécula-alvo do H19 e do ALDH2. No entanto, as funções regulatórias do eixo H19/miR-103-3p/ALDH2/PI3K/AKT na CMD ainda não foram investigadas.

A orientina é um componente flavonoide presente em plantas naturais, incluindo folhas de bambu, samambaia ocotillo, hidraste e benta.20 A orientina exerce diversos efeitos farmacológicos, como cardioproteção, neuroproteção, antiviral, antioxidante, antienvelhecimento, anticancerígeno e anti-inflamatório.21-24 Fu et al. relataram que a orientina é protetora contra o miocárdio tratado com isquemia/reperfusão e atenua a apoptose ao suprimir a ativação da via de apoptose mitocondrial.25 Li et al. relataram que a orientina atenua a remodelação cardíaca e reduz o infarto do miocárdio em camundongos através da via eNOS/NO.26 A orientina pode proteger podócitos e células endoteliais contra alterações morfológicas mitocondriais induzidas por altos níveis de glicose, apoptose, inflamação e estresse oxidativo.27,28 Além disso, a orientina pode resistir ao estresse oxidativo para exercer benefícios neuroprotetores29 e conferir cardioproteção contra reperfusão,30 ativando a sinalização PI3K/AKT. No entanto, os efeitos da orientina na CMD são amplamente desconhecidos.

Neste estudo, desenvolvemos modelos de CMD in vivo e in vitro para elucidar o papel do eixo de sinalização H19/miR-103-3p/ALDH2/PI3K/AKT nas funções regulatórias da orientina na CMD. Este estudo pode fornecer insights sobre o modo molecular de ação da orientina na doença cardíaca.

 Materiais e métodos Animais e tratamentos

Camundongos machos C57BL/6 (18 a 20 g; Beijing Vital River Laboratory) foram alojados em condições padrão (umidade de 60%; temperatura de 25 ± 1 ºC; ciclo claro/escuro de 12 h). Todos os procedimentos experimentais foram aprovados pelo Comitê de Pesquisa e Uso Animal da Wuhan Myhalic Biotechnology Co., Ltd (HLK-20240516003-003; 18 de julho de 2024).

O modelo de CMD foi estabelecido com uma dieta rica em gordura (Research Diet D12492) por 28 dias, seguida de jejum noturno e injeção intraperitoneal de estreptozotocina (50 mg/kg × 5 dias; 60256ES60; Shanghai Yeasen Biotechnology) dissolvida em tampão citrato de sódio (pH 4,5). Após 7 dias, os animais com hiperglicemia (glicemia ≥ 16,7 mmol/L) foram considerados camundongos DM31 e continuaram a ser alimentados com uma dieta rica em gordura. Os camundongos controle foram injetados com tampão citrato de sódio (pH 4,5) e alimentados com uma dieta normal. Os camundongos foram divididos em 5 grupos (n=8 por grupo): controle (camundongos controle tratados com solução salina normal); DM (camundongos DM tratados com solução salina normal); DM + Orientina (10 mg/kg) (camundongos DM tratados com 10 mg/kg de Orientina, MBS5750979; MyBiosource, Inc.); DM + Orientina (20 mg/kg) (camundongos DM tratados com 20 mg/kg de Orientina); DM + Orientina (40 mg/kg) (camundongos DM tratados com 40 mg/kg de Orientina). Orientina foi administrado intraperitonealmente uma vez ao dia (dissolvido em DMSO; um volume de 50 μl). Todos os grupos experimentais foram tratados por 12 semanas.

 Ecocardiografia

Os camundongos foram anestesiados com isoflurano a 0,5% e seus tórax foram raspados. A ecocardiografia em modo M foi realizada para avaliar a função cardíaca dos camundongos utilizando um Sistema de Microimagem de Alta Resolução (VeVo 770; VisualSonics Inc.). Parâmetros ecocardiográficos, incluindo diâmetro diastólico do ventrículo esquerdo (DVDVE), diâmetro sistólico do ventrículo esquerdo (DSVE), fração de ejeção do ventrículo esquerdo (FEVE) e encurtamento fracionário do ventrículo esquerdo (FSVE), foram medidos. Todas as medidas foram calculadas a partir de 5 ciclos cardíacos contínuos.

 Índice cardíaco

Os camundongos foram pesados e eutanasiados por inalação de CO2. A cavidade torácica foi aberta e o coração foi perfundido com 0,1 M de KCl. Após o coração parar de bater, o sangue residual foi removido com solução salina. O coração foi excisado e lavado três vezes. O coração foi seco em papel de filtro e pesado.

 Histologia

O tecido cardíaco de camundongo foi fixado em formalina a 10% (Top0372; Beijing Biotopped Life Sciences), desidratado e incluído em parafina. O tecido foi cortado em secções de 5 μm, colocadas em lâminas de vidro e coradas com hematoxilina-eosina (H&E; RS3390; Beijing G-Clone Biotechnology) utilizando o método padrão. A coloração tricrômica de Masson (RS3960l; Beijing G-Clone Biotechnology) foi utilizada para estimar a deposição de colágeno e a fibrose no coração. As alterações patológicas foram observadas ao microscópio Olympus CKX41. Cinco campos por secção cardíaca foram analisados utilizando o programa Image-Pro Plus 6.0.

 Detecção de lactato desidrogenase (LDH), creatina quinase-MB e troponina (cTnI)

Amostras de sangue foram obtidas do canto interno dos olhos dos camundongos e centrifugadas a 3.000×g por 15 minutos a 4°C. Indicadores de lesão cardíaca, incluindo LDH, CK-MB e cTnI no soro, foram medidos utilizando o Kit ELISA para LDH em Camundongo (ZK-M4619; Shenzhen Ziker Biotechnology), o Kit ELISA para CK-MB (ZK-M4805; Shenzhen Ziker Biotechnology) e o Kit ELISA para cTnI (JYM0409Mo; Wuhan Jiyinmei Biotechnology), respectivamente, seguindo os protocolos do fabricante.

 Coloração TUNEL

Para detectar a morte celular cardíaca, o ensaio TUNEL foi realizado utilizando o Kit de Detecção de Apoptose TUNEL FITC (A111-01; Nanjing Vazyme Biotechnology), seguindo as instruções do fabricante. Os núcleos foram marcados com DAPI (40727ES10; Shanghai Yeasen Biotechnology). As imagens foram obtidas utilizando um microscópio confocal Leica SP8. Cinco campos por secção cardíaca foram analisados utilizando o Image-Pro Plus 6.0.

 Células e tratamentos

Cardiomiócitos de camundongo HL-1 (ml096513; Shanghai mlbio) foram incubados em meio DMEM contendo 10% de SFB e 100 U/ml de penicilina-estreptomicina sob 5% de CO2/95% de ar a 37°C. Quando as células atingiram 70%-80% de confluência, foram expostas a glicose normal (5,5 mmol/L) ou glicose alta (33 mmol/L) e/ou orientina (2,5-20 μM) por 24 h. Para explorar os mecanismos de proteção da orientina, as células foram tratadas com 10 μM de LY294002 (um inibidor de PI3K; BES250679D; Shanghai BIOSEN Biotechnology) 2 h antes do tratamento com orientina.

 Transfecção

Cardiomiócitos de camundongo HL-1 foram transfectados com o vetor de superexpressão de H19 pcDNA3.1/H19 (H19), miR-103-3p ou siRNA direcionado a ALDH2 (si-ALDH2) (todos da Shanghai GenePharm Biotechnology) usando Lipofectamine 2000 (168019; Thermo Fisher Scientific, Inc.) seguindo os protocolos do fabricante. Vetor vazio (vetor), NC mimic e si-NC atuaram como controles negativos. Alterações nas expressões de RNA e proteína foram detectadas por qPCR e western blot 48 h após a transfecção.

 Ensaio CCK-8

Cardiomiócitos HL-1 foram semeados em placas de 96 poços (0,8-1 × 103 células/poço) durante a noite e tratados com glicose alta (33 mmol/L) e/ou orientina (2,5-20 μM) por 24 h. Em seguida, 10 µL de CCK-8 (40203ES60; Shanghai Yeasen Biotechnology) na concentração de 5 mg/mL foram adicionados a cada poço. Após o cultivo das células por 3-4 h a 37 °C, a absorbância a 450 nm foi medida utilizando um leitor de microplacas inteligente SMR16.1 (Wuhan USCNK IT LIFE SCIENCE INC.).

 Detecção de glutationa (GSH), superóxido dismutase (SOD), 4-hidroxinonenal (4-HNE) e malondialdeído (MDA).

Após homogeneizar 0,1 g de tecido cardíaco congelado com 1 mL de água destilada, o homogeneizado de tecido foi centrifugado a 12.000 rpm por 15 minutos. As células HL-1 foram lavadas com PBS (pH 7,2) e homogeneizadas em PBS contendo 0,5 mM de butil-hidroxitolueno. O homogeneizado foi centrifugado a 3.000 x g por 15 minutos a 4 °C. Glutationa (GSH), superóxido dismutase (SOD), 4-hidroxinonenal (4-HNE), malondialdeído (MDA) e ROS no sobrenadante foram detectados utilizando o Kit ELISA para GSH em camundongos (BLL-yx2756; Shanghai Baililai Biotechnology), o Kit ELISA para SOD (BLL-yx3040; Shanghai Baililai Biotechnology), o Kit ELISA para 4-HNE (YS03024B; Shanghai Yaji Biotechnology), o Kit ELISA para MDA (BLL-yx3039; Shanghai Baililai Biotechnology) e o Kit de Ensaio para ROS (DCFH-DA; S0033; Shanghai Beyotime Biotechnology), respectivamente, seguindo os protocolos do fabricante. Os níveis de ROS foram detectados por citometria de fluxo.

 RT-qPCR

Os RNAs totais foram isolados do tecido cardíaco e de células HL-1 utilizando o Extrator de RNA Total (zk3074; Shenzhen Zike Biotechnology) e transcritos reversamente em cDNA utilizando o Kit de Síntese de cDNA HiFiScript (AD502A; Shanghai Proteinssci Biotechnology), seguindo os protocolos do fornecedor. A reação de PCR foi realizada com o Power SYBR Green PCR Master Mix (Applied Biosystems) em um Sistema de PCR Rápido em Tempo Real 7900HT (Applied Biosystems). A expressão gênica foi calculada utilizando o método do ciclo limiar, que foi normalizado para GAPDH ou U6. As sequências de primers utilizadas para RT-qPCR são mostradas na Tabela 1.

– Sequências de primers usadas para RT-qPCR
Alvo(rato) Sequências de primers (5´-3´)
H19 F: CATTCTAGGCTGGGGTCAA
H19 R: GCCCTTCTTTTCCATTCTCC
miR-103-3p F: ACACTCCAGCTGGGAGCAGCATTGTAC
miR-103-3p R: TGGTGTCGTGGAGTCG
ALDH2 F: GCTGTTGTACCGATTGGCGGAT
ALDH2 R: GCGGAGACATTTCAGGACCATG
GAPDH F: TGCACCACCAACTGCTTAG
GAPDH R: GGATGCAGGGATGATGTTC
U6 F: CTCGCTTCGGCAGCACA
U6 R: AACGCTTCACGAATTGCGT

Western blot

O isolamento de proteínas totais e a análise de Western blot foram conduzidos conforme descrito por Liu et al.32 Os anticorpos primários incluíram Bax (ab32503; 1:1500; Abcam), caspase3 clivada (#AF7022; 1:1500; afinidade), Bcl-2 (ab182858; 1:2000; Abcam), ALDH2 (#DF6358; 1:1500; afinidade), p-PI3K (#AF3241; 1:1500; afinidade), PI3K (#AF6241; 1:1500; afinidade), p-AKT (#AF0016; 1:1500; afinidade), AKT (#AF6261; 1:1500; afinidade) e GAPDH (#AF7021; 1:15000; afinidade). As bandas de proteína foram capturadas por substrato de quimioluminescência aprimorada (ES-0006; Wuhan FineTest Biotechnology). A análise densitométrica foi realizada utilizando o Image-Pro Plus 6.0.

 Ensaio do repórter de luciferase

Fragmentos selvagens (Wt) ou mutantes (Mut) de H19 e ALDH2 3’UTR contendo os sítios de ligação previstos para mmu-miR-103-3p foram inseridos no vetor Promega pmirGLO para construir os plasmídeos, incluindo H19-Wt/Mut e ALDH2-Wt/Mut, respectivamente. Células HL-1 foram semeadas em placas de 24 poços e transfectadas com esses plasmídeos repórter de luciferase, juntamente com o mimetizador de miR-103-3p ou o mimetizador de NC, utilizando Lipofectamine 2000. Após 48 h, a atividade da luciferase foi determinada utilizando o Kit de Ensaio do Repórter de Luciferase Promega.

 Análise estatística

A normalidade da distribuição dos dados foi verificada pelo teste de Shapiro-Wilk (p>0,05 para todos os grupos). Todos os valores são apresentados como média ± desvio padrão. ANOVA unidirecional com teste de Tukey foi utilizada para determinar diferenças significativas entre os grupos. P < 0,05 foi considerado estatisticamente significativo. Todas as análises foram realizadas no software SPSS v.21.0. Cada experimento foi repetido três vezes. Para estudos com animais, o tamanho da amostra foi determinado pela análise de poder estatístico (visando 80% de poder para detectar uma mudança de 30% nos desfechos primários em α=0,05).

 Resultados Orientina melhora a lesão cardíaca em camundongos DM

Conforme mostrado na Tabela 2, comparado ao grupo controle, o grupo DM apresentou maiores níveis de glicose sanguínea, peso cardíaco e peso corporal (p<0,05). Orientina não teve impacto nos níveis de glicose sanguínea e peso corporal. Comparado ao grupo DM, orientina em doses de 20 e 40 mg/kg reduziu significativamente o peso cardíaco em camundongos (p<0,05). Dados de ecocardiografia em modo M na Tabela 3 indicaram que a FEVE e a FSVE foram reduzidas, e DVDVE e DSVE foram marcadamente aumentadas em camundongos diabéticos em comparação aos camundongos controle (p<0,05). Orientina em doses de 20 e 40 mg/kg elevou a FEVE e reduziu a DVDVE, e orientina em uma dose de 40 mg/kg elevou a FSVE e reduziu a DSVE (p<0,05). A coloração H&E da seção cardíaca no grupo controle exibiu morfologia normal de cardiomiócitos e fibras miocárdicas regulares. Entretanto, o tecido miocárdico no grupo com diabetes mellitus (DM) apresentou arquitetura desordenada evidente dos cardiomiócitos e hipertrofia miocárdica em comparação ao grupo controle. Orientina (20 e 40 mg/kg) melhorou a maioria das alterações patológicas (Figura 1A). As atividades séricas de LDH, CK-MB e cTnI, importantes indicadores de lesão cardíaca, foram estimadas. Os dados indicaram que as atividades séricas desses indicadores foram notavelmente aumentadas em camundongos diabéticos em comparação aos camundongos controle. Orientina nas doses de 20 e 40 mg/kg restaurou significativamente suas atividades em comparação aos camundongos diabéticos (Figura 1B-D). A coloração de Masson mostrou deposição significativa de colágeno no coração de camundongos com DM, que foi melhorada pela administração de Orientina (Figura 1E-F).

– Efeitos da orientina sobre a glicemia, peso cardíaco, e peso corporal em camundongos diabéticos
Índices Controle DM DM + Orientina (10 mg/kg) DM + Orientina (20 mg/kg) DM + Orientina (40 mg/kg)
Glicemia (mM) 8,24±1,14 22,31±1,78* 21,95±1,97 20,77±2,54 22,45±2,64
Peso do coração (mg) 111,25±9,14 138,67±11,09* 129,98±12,73 118,62±9,14# 120,08±8,98#
Peso corporal (g) 27,54±1,24 36,78±2,89* 35,22±1,79 36,02±3,11 37,15±2,52

Todos os valores são apresentados como média ± desvio padrão e analisados usando ANOVA unidirecional. N=8 por grupo. *p<0,05 vs grupo controle; #p<0,05 vs grupo DM. DM: diabetes mellitus.

– Efeitos da orientina nas funções ventriculares esquerdas em camundongos diabéticos
Índices Controle DM DM + Orientina (10 mg/kg) DM + Orientina (20 mg/kg) DM + Orientina (40 mg/kg)
%FEVE 610,91±3,25 38,57±2,37* 39,45±3,05 42,67±2,90# 53,74±3,75#
FSVE% 31,57±1,76 17,98±1,38* 19,64±1,12 19,99±1,24 25,86±1,47#
DVDVE (milímetros) 3,86±0,34 4,77±0,27* 40,61±0,66 4,06±0,86# 3,99±0,25#
DSVE (milímetros) 2,61±0,11 3,68±0,41* 3,44±0,66 3,38±0,14 2,76±0,09#

Todos os valores são apresentados como média ± desvio padrão e analisados usando ANOVA unidirecional. N=8 por grupo. *p<0,05 vs grupo controle; #p<0,05 vs grupo DM. DM: diabetes mellitus; DVDE: diâmetro diastólico do ventrículo esquerdo; DSVE: diâmetro sistólico do ventrículo esquerdo; FEVE: fração de ejeção do ventrículo esquerdo; FSVE: encurtamento fracionário do ventrículo esquerdo.

– Orientina melhora lesão cardíaca em camundongos com DM. (A) Alterações histológicas medidas pela coloração H&E. Barra de escala = 50 μm. (B-D) Efeitos da orientina nas atividades séricas de LDH, CK-MB e cTnI em camundongos com DM. ANOVA unidirecional. (E-F) Coloração de Masson de secção cardíaca e análise quantitativa. Barra de escala = 50 μm. ANOVA unidirecional. N = 8 por grupo. ***p < 0,01 vs grupo controle; #p < 0,05, ##p < 0,01, ###p < 0,001 vs grupo com DM. DM: diabetes mellitus.

Orientina alivia a apoptose miocárdica e o estresse oxidativo em camundongos com DM.

Como a orientina, na dose de 40 mg/kg, apresentou os melhores efeitos cardioprotetores, utilizamos essa dose em experimentos subsequentes. O grupo diabético apresentou um número maior de cardiomiócitos TUNEL-positivos no coração do que o grupo controle. A administração de orientina reverteu essa tendência e reduziu a apoptose dos cardiomiócitos (Figura 2A-B). A orientina também restaurou os níveis de proteínas relacionadas à apoptose em camundongos diabéticos, como demonstrado pela regulação positiva de Bcl-2 e regulação negativa de Bax e pela clivação de caspase-3 no grupo diabético, em comparação com o grupo diabético (Figura 2C-D). Avaliamos os níveis de parâmetros relacionados ao estresse oxidativo. Camundongos diabéticos apresentaram reduções significativas nas atividades cardíacas de GSH e SOD e aumentos nos níveis de MDA e 4-HNE em comparação com o grupo controle, que foram notavelmente restaurados pela orientina (Figura 2E-H).

– Orientina alivia a apoptose miocárdica e o estresse oxidativo em camundongos com DM. (A-B) Coloração TUNEL da secção cardíaca e análise quantitativa. Barra de escala = 20 μm. ANOVA unidirecional. (C-D) Dados de Western blot mostrando os níveis de proteínas relacionadas à apoptose nos corações dos camundongos. ANOVA unidirecional. (E-H) Atividades de GSH e SOD, bem como níveis de MDA e 4-HNE nos corações dos camundongos. ANOVA unidirecional. N = 8 por grupo. ***p < 0,01 vs grupo controle; ##p < 0,01, ###p < 0,001 vs grupo com DM.

Efeitos da orientina no eixo H19/miR-103-3p/ALDH2/PI3K/AKT em camundongos DM

Dados de RT-qPCR mostraram que, em camundongos diabéticos, H19 e ALDH2 no miocárdio foram notavelmente regulados negativamente, enquanto miR-103-3p foi regulado positivamente, em comparação com camundongos controle. Seus níveis de expressão foram restaurados após o tratamento com orientina (Figura 3A). Além disso, os níveis proteicos de ALDH2 e PI3K e AKT fosforilados foram marcadamente menores no grupo com diabetes do que no grupo controle, sendo revertidos no grupo tratado com orientina (Figura 3B-C).

– Efeitos da orientina no eixo H19/miR-103-3p/ALDH2/PI3K/AKT em camundongos com DM. (A) Dados de RT-qPCR mostrando as expressões de H19, miR-103-3p e ALDH2 em corações de camundongos. ANOVA unidirecional. (B-C) Western blot mostrando os níveis de ALDH2 e PI3K e AKT fosforilados em corações de camundongos. ANOVA unidirecional. N = 8 por grupo. ***p < 0,01 vs grupo controle; ###p < 0,001 vs grupo com DM.

Orientina reduz o estresse oxidativo e a apoptose desencadeados por altos níveis de glicose em células HL-1.

Os resultados do CCK-8 indicaram que a orientina em doses de 2,5 a 20 μM não influenciou a viabilidade das células HL-1 (Figura 4A). A orientina em doses de 5, 10 e 20 μM resgatou a viabilidade das células HL suprimida por altos níveis de glicose (Figura 4B), e 10 μM de orientina apresentaram os efeitos mais significativos. Utilizamos 10 μM de orientina em experimentos subsequentes. Conforme apresentado nas Figuras 4C-F, altos níveis de glicose aumentaram os níveis de ROS e MDA e diminuíram as atividades de SOD, que foram revertidas pelo pré-tratamento com orientina. O pré-tratamento com orientina restaurou os níveis proteicos de Bax, Bcl-2, caspase-3 clivada, ALDH2 e PI3K e AKT fosforilados em cardiomiócitos HL-1 tratados com altos níveis de glicose (Figura 4G-H). Além disso, as expressões reduzidas de H19 e ALDH2 e o aumento da expressão de miR-103-3p em células HL-1 tratadas com alto teor de glicose foram revertidas pelo pré-tratamento com orientina (Figura 4I).

– Orientina reduz o estresse oxidativo e a apoptose desencadeados por altos níveis de glicose em células HL-1. (A-B) Viabilidade de células HL-1 após tratamento com orientina e/ou altos níveis de glicose, medida por CCK-8. ANOVA unidirecional. (C-F) Efeitos da orientina sobre os níveis de ROS e MDA e atividades de SOD em células HL-1. ANOVA unidirecional. (G-H) Western blot mostrando os níveis de Bax, Bcl-2, caspase-3 clivada, ALDH2 e PI3K e AKT fosforilados em cardiomiócitos HL-1. ANOVA unidirecional. (I) Dados de RT-qPCR mostrando as expressões de H19, miR-103-3p e ALDH2 em cardiomiócitos HL-1. ANOVA unidirecional. N = 3 por grupo. ***p < 0,01 vs grupo controle; ###p < 0,001 vs grupo DM.

O eixo H19/miR-103-3p/ALDH2 regula o estresse oxidativo e a apoptose em células HL-1

Os sítios de ligação onde H19 ou ALDH2 interagem com miR-103-3p são mostrados na Figura 5A. A sequência H19/ALDH2 ou sua versão mutante foi cotransfetada em células HL-1 com o mimetizador miR-103-3p. Os dados indicaram reduções significativas nas atividades da luciferase após cotransfecções com H19-Wt ou ALDH1-Wt e mimetizador miR-103-3p, enquanto as cotransfecções com H19-Mut ou ALDH1-Mut e mimetizador miR-103-3p não alteraram as atividades da luciferase (Figura 5B). Descobrimos que a superexpressão de H19 restaurou os níveis proteicos de Bax, Bcl-2, caspase-3 clivada, ALDH2 e PI3K e AKT fosforilados em cardiomiócitos HL-1 tratados com altos níveis de glicose, que foram revertidos pela superexpressão de miR-103-3p ou pela depleção de ALDH2 (Figura 5C-D). Além disso, a superexpressão de H19 inibiu a produção de ROS desencadeada por altos níveis de glicose em células HL-1, mas a superexpressão de miR-103-3p ou a depleção de ALDH2 anularam os efeitos da superexpressão de H19 (Figura 5E).

– O eixo H19/miR-103-3p/ALDH2 regula o estresse oxidativo e a apoptose em células HL-1. (A) Diagrama representando os sítios de ligação entre H19/ALDH2 e miR-103-3p. (B) Ensaio de repórter de luciferase mostrando atividades de luciferase após cotransfecções com H19-Wt/Mut ou ALDH1-Wt/Mut e mimetizador de miR-103-3p. ANOVA bidirecional. ***p<0,01 vs. grupo mimetizador NC. (C-D) Western blot mostrando níveis de Bax, Bcl-2, caspase3 clivada, ALDH2 e PI3K e AKT fosforilados em cardiomiócitos HL-1. ANOVA unidirecional. (E) Níveis de ROS em cardiomiócitos HL-1. ANOVA unidirecional. N=3 por grupo. ***p<0,01 vs. grupo controle; ###p<0,001 vs grupo HG + Vetor + NC mimic + si-NC; &&&p<0,001 vs grupo HG + H19.

A depleção de H19 ou inibidor de PI3K reverte os efeitos da orientina em células HL-1

Para os experimentos de resgate, cardiomiócitos HL-1 sob condições de alta glicose foram tratados com orientina e/ou com depleção de H19 ou inibidor de PI3K (LY294002). Os resultados mostraram que as alterações nos níveis de Bax, Bcl-2, caspase-3 clivada, ALDH2 e PI3K e AKT fosforiladas causadas pelo tratamento com orientina foram notavelmente revertidas pela redução de H19 ou pelo tratamento com LY294002 (Figura 6A-B). Além disso, a redução de H19 ou o tratamento com LY294002 neutralizaram os efeitos da orientina sobre os níveis de ROS e MDA e sobre as atividades da SOD em células HL-1 tratadas com alta glicose (Figura 6C-E).

– A depleção de H19 ou o inibidor de PI3K revertem os efeitos da orientina em células HL-1. (A-B) Western blot mostrando os níveis de Bax, Bcl-2, caspase-3 clivada, ALDH2 e PI3K e AKT fosforilados em cardiomiócitos HL-1. ANOVA unidirecional. (C-E) Níveis de ROS e MDA e atividades de SOD em células HL-1. ANOVA unidirecional. N = 3 por grupo. ***p < 0,01 vs grupo controle; ###p < 0,001 vs grupo HG; &&&p < 0,001 vs grupo HG + Orientina.

Discussão

Neste estudo, o tratamento com orientina aliviou a deterioração da função cardíaca em camundongos com CMD e protegeu contra fibrose cardíaca, apoptose e estresse oxidativo induzidos por diabetes. Mecanicamente, a orientina restaurou as alterações nos níveis de H19, miR-103-3p e ALDH2, bem como na via PI3K/AKT, causadas pela hiperglicemia. Esta investigação, pela primeira vez, revela que o eixo H19/miR-103-3p/ALDH2/PI3K/AKT desempenha um papel fundamental na ação cardioprotetora da orientina na CMD.

A orientina foi proposta como um composto promissor para o tratamento de doenças cardiovasculares. A orientina pode exercer efeitos antioxidantes e antiapoptóticos em células endoteliais vasculares tratadas com LDL-ox e pode proteger contra a aterosclerose.33 A orientina diminui a resposta inflamatória, a fibrose e a apoptose de cardiomiócitos em camundongos após infarto do miocárdio. Além disso, a orientina atenua a apoptose e o estresse oxidativo em cardiomiócitos expostos à hipóxia.25,26 Complicações macrovasculares do diabetes, incluindo CMD, ocorrem por meio de múltiplos mecanismos induzidos por hiperglicemia nos quais o estresse oxidativo tem um papel central.34 O estresse oxidativo cardíaco está associado à redução do desempenho e da contratilidade cardíacos e ao aumento da fibrose e hipertrofia cardíacas, resultando em disfunção cardíaca grave e eventos cardíacos fatais.35 O estresse oxidativo mediado por hiperglicemia persistente pode ativar a sinalização apoptótica no coração para induzir a morte de cardiomiócitos.36,37 Neste estudo, a orientina não influenciou os níveis de glicose sanguínea em camundongos DM. Ainda assim, ela melhorou significativamente a disfunção cardíaca induzida por diabetes em camundongos, independentemente da modulação dos níveis de glicose sanguínea, possivelmente por meio da inibição do estresse oxidativo cardíaco e da apoptose. A ecocardiografia em modo M confirmou que a orientina melhorou a disfunção cardíaca induzida por hiperglicemia. Análises morfológicas e de coloração demonstraram ainda que a orientina melhorou o dano ao tecido cardíaco induzido por diabetes. LDH, CK-MB e cTnI são marcadores bioquímicos importantes que refletem o grau de lesão cardíaca.38 Neste caso, a orientina reduziu acentuadamente os níveis de LDH, CK-MB e cTnI no soro de camundongos com DM.

A rede lncRNA-miRNA-mRNA ceRNA tem sido relatada como envolvida na regulação dos processos patológicos da CMD.39-41 H19, um lncRNA abundante no sistema cardiovascular, atua como um ceRNA para desempenhar um papel em complicações relacionadas ao diabetes.42,43 Além disso, H19 está emergindo como um regulador potencialmente importante da doença cardíaca.44 Conforme relatado, a superexpressão de H19 melhora a disfunção ventricular esquerda no DM, reduzindo a apoptose e a fibrose dos cardiomiócitos.14 A decocção de Shengjie Tongyu protege contra lesão cardíaca diabética por meio da regulação positiva de H19.45 Embora tenha sido relatado que a orientina confere cardioproteção no nível proteico, não foi investigado se a orientina poderia modular a rede de ceRNA. Aqui, confirmamos que a orientina restaurou a expressão de H19 e diminuiu a expressão de miR-103-3p in vivo e in vitro. H19 poderia se ligar ao miR-103-3p como uma esponja. O miR-103-3p pertence à família miR-103/107 e foi relatado como aumentando a necrose programada dos cardiomiócitos em lesões isquêmicas do miocárdio.46

Além disso, o miR-103-3p promove hipertrofia e produção de ROS no modelo de insuficiência cardíaca.47 Os efeitos do miR-103-3p na cardiomiopatia dilatada (CMD) são desconhecidos. Aqui, demonstramos que o miR-103-3p anulou os efeitos inibitórios da superexpressão de H19 na apoptose e no estresse oxidativo em células HL-1 sob condições de alta glicose. Além disso, o H19 pode regular positivamente a ALDH2, um alvo do miR-103-3p, em células HL-1 tratadas com alta glicose. Yu et al. demonstraram que a ALDH2 é um mediador crucial na cardioproteção do pós-condicionamento isquêmico remoto por meio da via dependente de PI3K/AKT.48 A ALDH2 alivia a lesão isquêmica na CMD por meio da ativação da via PI3K/AKT.19 Descobrimos que os efeitos da H19 nos níveis de proteínas relacionadas à apoptose e à ALDH2/PI3K/AKT em condições de alta glicose foram revertidos pela superexpressão de miR-103-3p ou pela redução de ALDH2, sugerindo que a H19 pode ativar a via ALDH2/PI3K/AKT ao competir com miR-103-3p. É importante ressaltar que a orientina pode aumentar a expressão de ALDH2 em cardiomiócitos com alta glicose. Os efeitos da orientina na apoptose e no estresse oxidativo dos cardiomiócitos foram revertidos pelo siRNA H19 ou por um inibidor de PI3K, demonstrando o papel fundamental do eixo H19/miR-103-3p/ALDH2/PI3K/AKT na ação cardioprotetora da orientina. Apesar desses achados, diversas limitações merecem consideração. Primeiramente, nosso modelo in vivo empregou camundongos diabéticos induzidos por estreptozotocina alimentados com uma dieta rica em gordura. Embora isso replique características-chave da CMD humana, não captura totalmente a complexidade da fisiopatologia do diabetes tipo 2, incluindo a disfunção gradual das células β. Em segundo lugar, o estudo se concentrou no eixo H19/miR-103-3p/ALDH2/PI3K/AKT como a principal via mecanística; outras cascatas de sinalização ou RNAs não codificantes podem contribuir para os efeitos cardioprotetores da orientina. Em terceiro lugar, a segurança e a farmacocinética a longo prazo da orientina em modelos diabéticos permanecem inexploradas. Estudos futuros usando modelos genéticos de diabetes, abordagens multiômicas e avaliações de toxicidade crônica fortaleceriam a tradução clínica.

 Conclusão

Em conclusão, nosso estudo demonstra que a orientina melhora a CMD atenuando o estresse oxidativo e a apoptose através do eixo de sinalização H19/miR-103-3p/ALDH2/PI3K/AKT. Este trabalho não apenas revela um novo mecanismo molecular para os efeitos cardioprotetores da orientina, como também identifica H19 e ALDH2 como potenciais alvos terapêuticos para a CMD. Dada a origem natural da orientina, esses achados corroboram sua promessa translacional como estratégia complementar contra complicações cardíacas induzidas pelo diabetes.

 Referências 1. Burnett C, Evans DD, Mueller K. Managing Diabetes Mellitus in the Emergency Department. Adv Emerg Nurs J. 2024;46(1):58-70. doi: 10.1097/TME.0000000000000500. Burnett C Evans DD Mueller K Managing Diabetes Mellitus in the Emergency Department Adv Emerg Nurs J 2024 46 1 58 70 10.1097/TME.0000000000000500 2. Paolillo S, Marsico F, Prastaro M, Renga F, Esposito L, Martino F, et al. Diabetic Cardiomyopathy: Definition, Diagnosis, and Therapeutic Implications. Heart Fail Clin. 2019;15(3):341-7. doi: 10.1016/j.hfc.2019.02.003. Paolillo S Marsico F Prastaro M Renga F Esposito L Martino F et al Diabetic Cardiomyopathy: Definition, Diagnosis, and Therapeutic Implications Heart Fail Clin 2019 15 3 341 347 10.1016/j.hfc.2019.02.003 3. Byrne NJ, Rajasekaran NS, Abel ED, Bugger H. Therapeutic Potential of Targeting Oxidative Stress in Diabetic Cardiomyopathy. Free Radic Biol Med. 2021;169:317-42. doi: 10.1016/j.freeradbiomed.2021.03.046. Byrne NJ Rajasekaran NS Abel ED Bugger H Therapeutic Potential of Targeting Oxidative Stress in Diabetic Cardiomyopathy Free Radic Biol Med 2021 169 317 342 10.1016/j.freeradbiomed.2021.03.046 4. Jubaidi FF, Zainalabidin S, Taib IS, Hamid ZA, Budin SB. The Potential Role of Flavonoids in Ameliorating Diabetic Cardiomyopathy Via Alleviation of Cardiac Oxidative Stress, Inflammation and Apoptosis. Int J Mol Sci. 2021;22(10):5094. doi: 10.3390/ijms22105094. Jubaidi FF Zainalabidin S Taib IS Hamid ZA Budin SB The Potential Role of Flavonoids in Ameliorating Diabetic Cardiomyopathy Via Alleviation of Cardiac Oxidative Stress, Inflammation and Apoptosis Int J Mol Sci 2021 22 10 5094 10.3390/ijms22105094 5. Liu R, Duan T, Yu L, Tang Y, Liu S, Wang C, et al. Acid Sphingomyelinase Promotes Diabetic Cardiomyopathy Via NADPH Oxidase 4 Mediated Apoptosis. Cardiovasc Diabetol. 2023;22(1):25. doi: 10.1186/s12933-023-01747-1. Liu R Duan T Yu L Tang Y Liu S Wang C et al Acid Sphingomyelinase Promotes Diabetic Cardiomyopathy Via NADPH Oxidase 4 Mediated Apoptosis Cardiovasc Diabetol 2023 22 1 25 10.1186/s12933-023-01747-1 6. Jia G, Hill MA, Sowers JR. Diabetic Cardiomyopathy: An Update of Mechanisms Contributing to This Clinical Entity. Circ Res. 2018;122(4):624-38. doi: 10.1161/CIRCRESAHA.117.311586. Jia G Hill MA Sowers JR Diabetic Cardiomyopathy: An Update of Mechanisms Contributing to This Clinical Entity Circ Res 2018 122 4 624 638 10.1161/CIRCRESAHA.117.311586 7. Núñez-Martínez HN, Recillas-Targa F. Emerging Functions of lncRNA Loci Beyond the Transcript Itself. Int J Mol Sci. 2022;23(11):6258. doi: 10.3390/ijms23116258. Núñez-Martínez HN Recillas-Targa F Emerging Functions of lncRNA Loci Beyond the Transcript Itself Int J Mol Sci 2022 23 11 6258 10.3390/ijms23116258 8. Tafrihi M, Hasheminasab E. MiRNAs: Biology, Biogenesis, their Web-Based Tools, and Databases. Microrna. 2019;8(1):4-27. doi: 10.2174/2211536607666180827111633. Tafrihi M Hasheminasab E MiRNAs: Biology, Biogenesis, their Web-Based Tools, and Databases Microrna 2019 8 1 4 27 10.2174/2211536607666180827111633 9. Li C, Wang D, Jiang Z, Gao Y, Sun L, Li R, et al. Non-Coding RNAs in Diabetes Mellitus and Diabetic Cardiovascular Disease. Front Endocrinol. 2022;13:961802. doi: 10.3389/fendo.2022.961802. Li C Wang D Jiang Z Gao Y Sun L Li R et al Non-Coding RNAs in Diabetes Mellitus and Diabetic Cardiovascular Disease Front Endocrinol 2022 13 961802 10.3389/fendo.2022.961802 10. Hussein RM. Long Non-Coding RNAs: The Hidden Players in Diabetes Mellitus-Related Complications. Diabetes Metab Syndr. 2023;17(10):102872. doi: 10.1016/j.dsx.2023.102872. Hussein RM Long Non-Coding RNAs: The Hidden Players in Diabetes Mellitus-Related Complications Diabetes Metab Syndr 2023 17 10 102872 10.1016/j.dsx.2023.102872 11. Ma X, Mei S, Wuyun Q, Zhou L, Sun D, Yan J. Epigenetics in Diabetic Cardiomyopathy. Clin Epigenetics. 2024;16(1):52. doi: 10.1186/s13148-024-01667-1. Ma X Mei S Wuyun Q Zhou L Sun D Yan J Epigenetics in Diabetic Cardiomyopathy Clin Epigenetics 2024 16 1 52 10.1186/s13148-024-01667-1 12. Chang W, Li W, Li P. The Anti-Diabetic Effects of Metformin are Mediated by Regulating Long Non-Coding RNA. Front Pharmacol. 2023;14:1256705. doi: 10.3389/fphar.2023.1256705. Chang W Li W Li P The Anti-Diabetic Effects of Metformin are Mediated by Regulating Long Non-Coding RNA Front Pharmacol 2023 14 1256705 10.3389/fphar.2023.1256705 13. Bi Y, Wang Y, Sun X. Recent Advances of LncRNA H19 in Diabetes LncRNA H19 in Diabetes. Horm Metab Res. 2022;54(4):212-9. doi: 10.1055/a-1769-5032. Bi Y Wang Y Sun X Recent Advances of LncRNA H19 in Diabetes LncRNA H19 in Diabetes Horm Metab Res 2022 54 4 212 219 10.1055/a-1769-5032 14. Wang S, Duan J, Liao J, Wang Y, Xiao X, Li L, et al. LncRNA H19 Inhibits ER Stress Induced Apoptosis and Improves Diabetic Cardiomyopathy by Regulating PI3K/AKT/mTOR Axis. Aging. 2022;14(16):6809-28. doi: 10.18632/aging.204256. Wang S Duan J Liao J Wang Y Xiao X Li L et al LncRNA H19 Inhibits ER Stress Induced Apoptosis and Improves Diabetic Cardiomyopathy by Regulating PI3K/AKT/mTOR Axis Aging 2022 14 16 6809 6828 10.18632/aging.204256 15. Su W, Huo Q, Wu H, Wang L, Ding X, Liang L, et al. The Function of LncRNA-H19 in Cardiac Hypertrophy. Cell Biosci. 2021;11(1):153. doi: 10.1186/s13578-021-00668-4. Su W Huo Q Wu H Wang L Ding X Liang L et al The Function of LncRNA-H19 in Cardiac Hypertrophy Cell Biosci 2021 11 1 153 10.1186/s13578-021-00668-4 16. Tao H, Cao W, Yang JJ, Shi KH, Zhou X, Liu LP, et al. Long Noncoding RNA H19 Controls DUSP5/ERK1/2 Axis in Cardiac Fibroblast Proliferation and Fibrosis. Cardiovasc Pathol. 2016;25(5):381-9. doi: 10.1016/j.carpath.2016.05.005. Tao H Cao W Yang JJ Shi KH Zhou X Liu LP et al Long Noncoding RNA H19 Controls DUSP5/ERK1/2 Axis in Cardiac Fibroblast Proliferation and Fibrosis Cardiovasc Pathol 2016 25 5 381 389 10.1016/j.carpath.2016.05.005 17. Gomes KM, Campos JC, Bechara LR, Queliconi B, Lima VM, Disatnik MH, et al. Aldehyde Dehydrogenase 2 Activation in Heart Failure Restores Mitochondrial Function and Improves Ventricular Function and Remodelling. Cardiovasc Res. 2014;103(4):498-508. doi: 10.1093/cvr/cvu125. Gomes KM Campos JC Bechara LR Queliconi B Lima VM Disatnik MH et al Aldehyde Dehydrogenase 2 Activation in Heart Failure Restores Mitochondrial Function and Improves Ventricular Function and Remodelling Cardiovasc Res 2014 103 4 498 508 10.1093/cvr/cvu125 18. Mali VR, Deshpande M, Pan G, Thandavarayan RA, Palaniyandi SS. Impaired ALDH2 Activity Decreases the Mitochondrial Respiration in H9C2 Cardiomyocytes. Cell Signal. 2016;28(2):1-6. doi: 10.1016/j.cellsig.2015.11.006. Mali VR Deshpande M Pan G Thandavarayan RA Palaniyandi SS Impaired ALDH2 Activity Decreases the Mitochondrial Respiration in H9C2 Cardiomyocytes Cell Signal 2016 28 2 1 6 10.1016/j.cellsig.2015.11.006 19. Tan X, Chen YF, Zou SY, Wang WJ, Zhang NN, Sun ZY, et al. ALDH2 Attenuates Ischemia and Reperfusion Injury Through Regulation of Mitochondrial Fusion and Fission by PI3K/AKT/mTOR Pathway in Diabetic Cardiomyopathy. Free Radic Biol Med. 2023;195:219-30. doi: 10.1016/j.freeradbiomed.2022.12.097. Tan X Chen YF Zou SY Wang WJ Zhang NN Sun ZY et al ALDH2 Attenuates Ischemia and Reperfusion Injury Through Regulation of Mitochondrial Fusion and Fission by PI3K/AKT/mTOR Pathway in Diabetic Cardiomyopathy Free Radic Biol Med 2023 195 219 230 10.1016/j.freeradbiomed.2022.12.097 20. Xiao Q, Qu Z, Zhao Y, Yang L, Gao P. Orientin Ameliorates LPS-Induced Inflammatory Responses Through the Inhibitory of the NF-?B Pathway and NLRP3 Inflammasome. Evid Based Complement Alternat Med. 2017;2017:2495496. doi: 10.1155/2017/2495496. Xiao Q Qu Z Zhao Y Yang L Gao P Orientin Ameliorates LPS-Induced Inflammatory Responses Through the Inhibitory of the NF-?B Pathway and NLRP3 Inflammasome Evid Based Complement Alternat Med 2017 2017 2495496 10.1155/2017/2495496 21. Law BN, Ling AP, Koh RY, Chye SM, Wong YP. Neuroprotective Effects of Orientin on Hydrogen Peroxide-Induced Apoptosis in SH-SY5Y Cells. Mol Med Rep. 2014;9(3):947-54. doi: 10.3892/mmr.2013.1878. Law BN Ling AP Koh RY Chye SM Wong YP Neuroprotective Effects of Orientin on Hydrogen Peroxide-Induced Apoptosis in SH-SY5Y Cells Mol Med Rep 2014 9 3 947 954 10.3892/mmr.2013.1878 22. Dhakal H, Lee S, Choi JK, Kwon TK, Khang D, Kim SH. Inhibitory Effects of Orientin in Mast Cell-Mediated Allergic Inflammation. Pharmacol Rep. 2020;72(4):1002-10. doi: 10.1007/s43440-019-00048-3. Dhakal H Lee S Choi JK Kwon TK Khang D Kim SH Inhibitory Effects of Orientin in Mast Cell-Mediated Allergic Inflammation Pharmacol Rep 2020 72 4 1002 1010 10.1007/s43440-019-00048-3 23. Wang L, Jing S, Qu H, Wang K, Jin Y, Ding Y, et al. Orientin Mediates Protection Against MRSA-Induced Pneumonia by Inhibiting Sortase A. Virulence. 2021;12(1):2149-61. doi: 10.1080/21505594.2021.1962138. Wang L Jing S Qu H Wang K Jin Y Ding Y et al Orientin Mediates Protection Against MRSA-Induced Pneumonia by Inhibiting Sortase A Virulence 2021 12 1 2149 2161 10.1080/21505594.2021.1962138 24. Song X, Fan X. Protective Effects of Orientin Against Spinal Cord Injury in Rats. Neuroreport. 2024;35(12):753-62. doi: 10.1097/WNR.0000000000002054. Song X Fan X Protective Effects of Orientin Against Spinal Cord Injury in Rats Neuroreport 2024 35 12 753 762 10.1097/WNR.0000000000002054 25. Fu XC, Wang MW, Li SP, Wang HL. Anti-Apoptotic Effect and the Mechanism of Orientin on Ischaemic/Reperfused Myocardium. J Asian Nat Prod Res. 2006;8(3):265-72. doi: 10.1080/10286020500207347. Fu XC Wang MW Li SP Wang HL Anti-Apoptotic Effect and the Mechanism of Orientin on Ischaemic/Reperfused Myocardium J Asian Nat Prod Res 2006 8 3 265 272 10.1080/10286020500207347 26. Li F, Zong J, Zhang H, Zhang P, Xu L, Liang K, et al. Orientin Reduces Myocardial Infarction Size via eNOS/NO Signaling and Thus Mitigates Adverse Cardiac Remodeling. Front Pharmacol. 2017;8:926. doi: 10.3389/fphar.2017.00926. Li F Zong J Zhang H Zhang P Xu L Liang K et al Orientin Reduces Myocardial Infarction Size via eNOS/NO Signaling and Thus Mitigates Adverse Cardiac Remodeling Front Pharmacol 2017 8 926 10.3389/fphar.2017.00926 27. Kong ZL, Che K, Hu JX, Chen Y, Wang YY, Wang X, et al. Orientin Protects Podocytes from High Glucose Induced Apoptosis Through Mitophagy. Chem Biodivers. 2020;17(3):e1900647. doi: 10.1002/cbdv.201900647. Kong ZL Che K Hu JX Chen Y Wang YY Wang X et al Orientin Protects Podocytes from High Glucose Induced Apoptosis Through Mitophagy Chem Biodivers 2020 17 3 e1900647 10.1002/cbdv.201900647 28. Ku SK, Kwak S, Bae JS. Orientin Inhibits High Glucose-Induced Vascular Inflammation in Vitro and in Vivo. Inflammation. 2014;37(6):2164-73. doi: 10.1007/s10753-014-9950-x. Ku SK Kwak S Bae JS Orientin Inhibits High Glucose-Induced Vascular Inflammation in Vitro and in Vivo Inflammation 2014 37 6 2164 2173 10.1007/s10753-014-9950-x 29. Sajini DV, Krishnamurthy PT, Chakkittukandiyil A, Mudavath RN. Orientin Modulates Nrf2-ARE, PI3K/Akt, JNK-ERK1/2, and TLR4/NF-kB Pathways to Produce Neuroprotective Benefits in Parkinson's Disease. Neurochem Res. 2024;49(6):1577-87. doi: 10.1007/s11064-024-04099-8. Sajini DV Krishnamurthy PT Chakkittukandiyil A Mudavath RN Orientin Modulates Nrf2-ARE, PI3K/Akt, JNK-ERK1/2, and TLR4/NF-kB Pathways to Produce Neuroprotective Benefits in Parkinson's Disease Neurochem Res 2024 49 6 1577 1587 10.1007/s11064-024-04099-8 30. Lu N, Sun Y, Zheng X. Orientin-Induced Cardioprotection Against Reperfusion is Associated with Attenuation of Mitochondrial Permeability Transition. Planta Med. 2011;77(10):984-91. doi: 10.1055/s-0030-1250718. Lu N Sun Y Zheng X Orientin-Induced Cardioprotection Against Reperfusion is Associated with Attenuation of Mitochondrial Permeability Transition Planta Med 2011 77 10 984 991 10.1055/s-0030-1250718 31. Zhong X, Wang T, Xie Y, Wang M, Zhang W, Dai L, et al. Activated Protein C Ameliorates Diabetic Cardiomyopathy via Modulating OTUB1/YB-1/MEF2B Axis. Front Cardiovasc Med. 2021;8:758158. doi: 10.3389/fcvm.2021.758158. Zhong X Wang T Xie Y Wang M Zhang W Dai L et al Activated Protein C Ameliorates Diabetic Cardiomyopathy via Modulating OTUB1/YB-1/MEF2B Axis Front Cardiovasc Med 2021 8 758158 10.3389/fcvm.2021.758158 32. Liu X, Zhao M, Xie Y, Li P, Wang O, Zhou B, et al. Null Mutation of the Fascin2 Gene by TALEN Leading to Progressive Hearing Loss and Retinal Degeneration in C57BL/6J Mice. G3. 2018;8(10):3221-30. doi: 10.1534/g3.118.200405. Liu X Zhao M Xie Y Li P Wang O Zhou B et al Null Mutation of the Fascin2 Gene by TALEN Leading to Progressive Hearing Loss and Retinal Degeneration in C57BL/6J Mice G3 2018 8 10 3221 3230 10.1534/g3.118.200405 33. Gao F, Zhao Y, Zhang B, Xiao C, Sun Z, Gao Y, et al. Orientin Alleviates ox-LDL-Induced Oxidative Stress, Inflammation and Apoptosis in Human Vascular Endothelial Cells by Regulating Sestrin 1 (SESN1)-Mediated Autophagy. J Mol Histol. 2024;55(1):109-20. doi: 10.1007/s10735-023-10176-z. Gao F Zhao Y Zhang B Xiao C Sun Z Gao Y et al Orientin Alleviates ox-LDL-Induced Oxidative Stress, Inflammation and Apoptosis in Human Vascular Endothelial Cells by Regulating Sestrin 1 (SESN1)-Mediated Autophagy J Mol Histol 2024 55 1 109 120 10.1007/s10735-023-10176-z 34. Peng ML, Fu Y, Wu CW, Zhang Y, Ren H, Zhou SS. Signaling Pathways Related to Oxidative Stress in Diabetic Cardiomyopathy. Front Endocrinol. 2022;13:907757. doi: 10.3389/fendo.2022.907757. Peng ML Fu Y Wu CW Zhang Y Ren H Zhou SS Signaling Pathways Related to Oxidative Stress in Diabetic Cardiomyopathy Front Endocrinol 2022 13 907757 10.3389/fendo.2022.907757 35. Faria A, Persaud SJ. Cardiac Oxidative Stress in Diabetes: Mechanisms and Therapeutic Potential. Pharmacol Ther. 2017;172:50-62. doi: 10.1016/j.pharmthera.2016.11.013. Faria A Persaud SJ Cardiac Oxidative Stress in Diabetes: Mechanisms and Therapeutic Potential Pharmacol Ther 2017 172 50 62 10.1016/j.pharmthera.2016.11.013 36. Dludla PV, Joubert E, Muller CJF, Louw J, Johnson R. Hyperglycemia-Induced Oxidative Stress and Heart Disease-Cardioprotective Effects of Rooibos Flavonoids and Phenylpyruvic Acid-2-O-ß-D-Glucoside. Nutr Metab. 2017;14:45. doi: 10.1186/s12986-017-0200-8. Dludla PV Joubert E Muller CJF Louw J Johnson R Hyperglycemia-Induced Oxidative Stress and Heart Disease-Cardioprotective Effects of Rooibos Flavonoids and Phenylpyruvic Acid-2-O-ß-D-Glucoside Nutr Metab 2017 14 45 10.1186/s12986-017-0200-8 37. Althunibat OY, Al Hroob AM, Abukhalil MH, Germoush MO, Bin-Jumah M, Mahmoud AM. Fisetin Ameliorates Oxidative Stress, Inflammation and Apoptosis in Diabetic Cardiomyopathy. Life Sci. 2019;221:83-92. doi: 10.1016/j.lfs.2019.02.017. Althunibat OY Al Hroob AM Abukhalil MH Germoush MO Bin-Jumah M Mahmoud AM Fisetin Ameliorates Oxidative Stress, Inflammation and Apoptosis in Diabetic Cardiomyopathy Life Sci 2019 221 83 92 10.1016/j.lfs.2019.02.017 38. Lin R, Duan J, Mu F, Bian H, Zhao M, Zhou M, et al. Cardioprotective Effects and Underlying Mechanism of Radix Salvia Miltiorrhiza and Lignum Dalbergia Odorifera in a Pig Chronic Myocardial Ischemia Model. Int J Mol Med. 2018;42(5):2628-40. doi: 10.3892/ijmm.2018.3844. Lin R Duan J Mu F Bian H Zhao M Zhou M et al Cardioprotective Effects and Underlying Mechanism of Radix Salvia Miltiorrhiza and Lignum Dalbergia Odorifera in a Pig Chronic Myocardial Ischemia Model Int J Mol Med 2018 42 5 2628 2640 10.3892/ijmm.2018.3844 39. Che H, Wang Y, Li H, Li Y, Sahil A, Lv J, et al. Melatonin Alleviates Cardiac Fibrosis Via Inhibiting lncRNA MALAT1/miR-141-Mediated NLRP3 Inflammasome and TGF-ß1/Smads Signaling in Diabetic Cardiomyopathy. FASEB J. 2020;34(4):5282-98. doi: 10.1096/fj.201902692R. Che H Wang Y Li H Li Y Sahil A Lv J et al Melatonin Alleviates Cardiac Fibrosis Via Inhibiting lncRNA MALAT1/miR-141-Mediated NLRP3 Inflammasome and TGF-ß1/Smads Signaling in Diabetic Cardiomyopathy FASEB J 2020 34 4 5282 5298 10.1096/fj.201902692R 40. Sun H, Wang C, Zhou Y, Cheng X. Long Noncoding RNA OIP5-AS1 Overexpression Promotes Viability and Inhibits High Glucose-Induced Oxidative Stress of Cardiomyocytes by Targeting MicroRNA-34a/SIRT1 Axis in Diabetic Cardiomyopathy. Endocr Metab Immune Disord Drug Targets. 2021;21(11):2017-27. doi: 10.2174/1871530321666201230090742. Sun H Wang C Zhou Y Cheng X Long Noncoding RNA OIP5-AS1 Overexpression Promotes Viability and Inhibits High Glucose-Induced Oxidative Stress of Cardiomyocytes by Targeting MicroRNA-34a/SIRT1 Axis in Diabetic Cardiomyopathy Endocr Metab Immune Disord Drug Targets 2021 21 11 2017 2027 10.2174/1871530321666201230090742 41. Luo Y, Jiang Y, Zhong T, Li Z, He J, Li X, et al. LncRNA HCG18 affects Diabetic Cardiomyopathy and its Association with miR-9-5p/IGF2R Axis. Heliyon. 2024;10(3):e24604. doi: 10.1016/j.heliyon.2024.e24604. Luo Y Jiang Y Zhong T Li Z He J Li X et al LncRNA HCG18 affects Diabetic Cardiomyopathy and its Association with miR-9-5p/IGF2R Axis Heliyon 2024 10 3 e24604 10.1016/j.heliyon.2024.e24604 42. Shi S, Song L, Yu H, Feng S, He J, Liu Y, et al. Knockdown of LncRNA-H19 Ameliorates Kidney Fibrosis in Diabetic Mice by Suppressing miR-29a-Mediated EndMT. Front Pharmacol. 2020;11:586895. doi: 10.3389/fphar.2020.586895. Shi S Song L Yu H Feng S He J Liu Y et al Knockdown of LncRNA-H19 Ameliorates Kidney Fibrosis in Diabetic Mice by Suppressing miR-29a-Mediated EndMT Front Pharmacol 2020 11 586895 10.3389/fphar.2020.586895 43. Zhu L, Li Y, Xia F, Xue M, Wang Y, Jia D, et al. H19: A Vital Long Noncoding RNA in the Treatment of Diabetes and Diabetic Complications. Curr Pharm Des. 2022;28(12):1011-8. doi: 10.2174/1381612827666211210123959. Zhu L Li Y Xia F Xue M Wang Y Jia D et al H19: A Vital Long Noncoding RNA in the Treatment of Diabetes and Diabetic Complications Curr Pharm Des 2022 28 12 1011 1018 10.2174/1381612827666211210123959 44. Li X, Zhang Y, Ding Z, Chen Y, Wang W. LncRNA H19: A Novel Biomarker in Cardiovascular Disease. Acta Cardiol Sin. 2024;40(2):172-81. doi: 10.6515/ACS.202403_40(2).20230925A. Li X Zhang Y Ding Z Chen Y Wang W LncRNA H19: A Novel Biomarker in Cardiovascular Disease Acta Cardiol Sin 2024 40 2 172 181 10.6515/ACS.202403_40(2).20230925A 45. Wang S, Duan J, Liao J, Wang Y, Xiao X, Li L, et al. Shengjie Tongyu Decoction Regulates Cardiomyocyte Autophagy Through Modulating ROS-PI3K/Akt/mTOR Axis by LncRNA H19 in Diabetic Cardiomyopathy. Altern Ther Health Med. 2023;29(6):280-7. Wang S Duan J Liao J Wang Y Xiao X Li L et al Shengjie Tongyu Decoction Regulates Cardiomyocyte Autophagy Through Modulating ROS-PI3K/Akt/mTOR Axis by LncRNA H19 in Diabetic Cardiomyopathy Altern Ther Health Med 2023 29 6 280 287 46. Wang JX, Zhang XJ, Li Q, Wang K, Wang Y, Jiao JQ, et al. MicroRNA-103/107 Regulate Programmed Necrosis and Myocardial Ischemia/Reperfusion Injury Through Targeting FADD. Circ Res. 2015;117(4):352-63. doi: 10.1161/CIRCRESAHA.117.305781. Wang JX Zhang XJ Li Q Wang K Wang Y Jiao JQ et al MicroRNA-103/107 Regulate Programmed Necrosis and Myocardial Ischemia/Reperfusion Injury Through Targeting FADD Circ Res 2015 117 4 352 363 10.1161/CIRCRESAHA.117.305781 47. Zhang X, Yuan S, Liu J, Tang Y, Wang Y, Zhan J, et al. Overexpression of Cytosolic Long Noncoding RNA Cytb Protects Against Pressure-Overload-Induced Heart Failure Via Sponging microRNA-103-3p. Mol Ther Nucleic Acids. 2022;27:1127-45. doi: 10.1016/j.omtn.2022.02.002. Zhang X Yuan S Liu J Tang Y Wang Y Zhan J et al Overexpression of Cytosolic Long Noncoding RNA Cytb Protects Against Pressure-Overload-Induced Heart Failure Via Sponging microRNA-103-3p Mol Ther Nucleic Acids 2022 27 1127 1145 10.1016/j.omtn.2022.02.002 48. Yu Y, Jia XJ, Zong QF, Zhang GJ, Ye HW, Hu J, et al. Remote Ischemic Postconditioning Protects the Heart by Upregulating ALDH2 Expression Levels Through the PI3K/Akt Signaling Pathway. Mol Med Rep. 2014;10(1):536-42. doi: 10.3892/mmr.2014.2156. Yu Y Jia XJ Zong QF Zhang GJ Ye HW Hu J et al Remote Ischemic Postconditioning Protects the Heart by Upregulating ALDH2 Expression Levels Through the PI3K/Akt Signaling Pathway Mol Med Rep 2014 10 1 536 542 10.3892/mmr.2014.2156

Não há vinculação deste estudo a programas de pós-graduação.

Este estudo foi aprovado pelo Comitê de Ética do Wuhan Myhalic Biotechnology Co., Ltd sob o número de protocolo HLK-20240516003-003. Todos os procedimentos envolvidos nesse estudo estão de acordo com a Declaração de Helsinki de 1975, atualizada em 2013.

Os autores não utilizaram ferramentas de inteligência artificial no desenvolvimento deste trabalho.

Todo o conjunto de dados que dá suporte aos resultados deste estudo está disponível mediante solicitação ao autor correspondente Jun Li.

Para informação adicional, por favor, clique aqui.

O presente estudo foi financiado por Wuhan Municipal Health Commision (WZ241346).

 10.36660/abc.20240885i Research Article Orientin Alleviates Oxidative Stress And Apoptosis In Diabetic Cardiomyopathy Via The Lncrna H19/Mir-103-3p/ALDH2/PI3K/AKT Axis Wang Xun Conception and design of the research Acquisition of data Analysis and interpretation of the data e Statistical analysis Obtaining financing Writing of the manuscript and Critical revision of the manuscript for content 1 Xiong Xiaofang Analysis and interpretation of the data e Statistical analysis 1 Jiang Wei Analysis and interpretation of the data e Statistical analysis 1 Xu Shanshan Analysis and interpretation of the data e Statistical analysis 1 0009-0000-0796-357X Li Jun Acquisition of data Obtaining financing Writing of the manuscript and Critical revision of the manuscript for content 1 China Wuhan Third Hospital, Wuhan - China Jun Li • Wuhan Third Hospital, No.241 Pengliuyang Road, Wuchang District, Wuhan City, Hubei Province - China E-mail: lijundr77@hotmail.com

No potential conflict of interest relevant to this article was reported.

Marina Okoshi

 Abstract Background

Diabetic cardiomyopathy (DCM) is an irreversible cardiovascular complication of diabetes mellitus characterized by detrimental cardiac remodeling. Orientin, a water-soluble flavonoid present in many medicinal plants, exerts various pharmacological effects.

 Objectives

To investigate the cardioprotective effects of orientin in diabetic conditions and elucidate the mechanisms associated with non-coding RNAs.

 Methods

The streptozotocin-induced DCM model was established by a combined use of streptozotocin and a high-fat diet. Cardiac structure and function in diabetes mellitus mice were evaluated using histological and echocardiographic analyses. Masson, TUNEL, western blot, and ELISA in mouse hearts were performed to analyze cardiac fibrosis, apoptosis, and oxidative stress. Expression levels of lncRNA H19, miR-103-3p, ALDH2, and PI3K/AKT-related proteins in mouse heart and HL-1 cells were evaluated using real-time qPCR or western blot. The significance level was set at p<0.05.

 Results

Orientin improved cardiac function and ameliorated cardiac injury in diabetic mice. Orientin inhibited cardiac fibrosis, reduced cardiomyocyte apoptosis, and increased the activities of antioxidant enzymes. In pathological conditions, H19 and ALDH2 levels were reduced while miR-103-3p levels increased, which were reversed by orientin. H19 upregulated ALDH2 expression by binding to miR-103-3p and activated the PI3K/AKT pathway in high glucose-treated HL-1 cells. H19 depletion or PI3K inhibitor reversed the effects of orientin on apoptosis and oxidative stress in HL-1 cells under high glucose conditions.

 Conclusions

These findings reveal a protective mechanism of orientin in DCM, which involves the regulation of the H19/miR-103-3p/ALDH2/PI3K/AKT signaling axis, providing a potential strategy for treating DCM.

Orientin Alleviates Oxidative Stress And Apoptosis In Diabetic Cardiomyopathy Via The Lncrna H19/Mir-103-3p/ALDH2/PI3K/AKT Axis

Cardiomyopathies Apoptosis Oxidative Stress Introduction

Diabetes mellitus (DM) is a metabolic illness that continues to rise in prevalence and is characterized by hyperglycemia resulting from inadequate insulin secretion, insulin resistance, or glucagon hypersecretion.1 Diabetic cardiomyopathy (DCM) is a cardiac manifestation of DM characterized by left ventricular diastolic dysfunction and hypertrophy in the early stages, later by heart failure with decreased systolic function.2 It is well established that cardiac structural and functional changes under DCM conditions are closely associated with hyperglycemia-induced persistent oxidative stress, resulting in cardiomyocyte death and cardiac dysfunction.3-5 Additionally, when the heart is severely damaged, excessive collagen leads to cardiac fibrosis and dysfunction.6 To date, the specific mechanisms associated with DCM are largely unknown, and there is no effective treatment for DCM. Therefore, it is needed to identify new therapeutic agents or targets.

Long non-coding (lncRNAs) have important regulatory functions in numerous cellular processes and diseases.7 MicroRNAs (miRNAs) participate in the regulatory functions of a variety of physiological activities.8 Studies suggest that abnormal expressions of ncRNAs are involved in human disease progression, including DCM.9-11 Evidence also indicates that treatment with drugs (such as metformin) for DM can alter ncRNA expression,12 implying that the modulation of ncRNA expression might be an important mechanism in DM treatment. LncRNA H19 participates in the regulatory processes of glucose metabolism, tumor metastasis, muscle differentiation, etc.13 H19 has been identified as a crucial molecule in cardiac disease, as it can regulate DCM,14 cardiac hypertrophy,15 and fibrosis.16 Aldehyde dehydrogenase 2 (ALDH2) plays a key role in mitochondrial respiration function and ventricular function remodeling.17,18 Moreover, ALDH2 alleviates ischemic injury in DCM through activation of the PI3K/AKT pathway.19 Our preliminary experiments showed that H19 could upregulate ALDH2 expression in mouse cardiomyocytes. By using online tools, we identified miR-103-3p as a target molecule of H19 and ALDH2. However, the regulatory functions of the H19/miR-103-3p/ALDH2/PI3K/AKT axis in DCM have not been investigated.

Orientin is a flavonoid component present in natural plants, including bamboo leaves, ocotillo fern, goldenseal, and holy.20 Orientin exerts various pharmacological effects, such as cardioprotective, neuroprotective antiviral, antioxidant, antiaging, anticancer, and anti-inflammatory activities.21-24 Fu et al. reported that orientin is protective against ischemia/reperfusion-treated myocardium and attenuates apoptosis by suppressing the activation of the mitochondria apoptosis pathway.25 Li et al. reported that orientin mitigates cardiac remodeling and reduces myocardial infarction in mice through the eNOS/NO pathway.26 Orientin can protect podocytes and endothelial cells against high glucose-induced mitochondrial morphological changes, apoptosis, inflammation, and oxidative stress.27,28 Additionally, orientin can resist oxidative stress to exert neuroprotective benefits29 and confer cardioprotection against reperfusion30 by activating PI3K/AKT signaling. However, the effects of orientin on DCM are largely unknown.

In this study, we developed DCM models in vivo and in vitro to elucidate the role of the H19/miR-103-3p/ALDH2/PI3K/AKT signaling axis in the regulatory functions of orientin in DCM. This study might provide insights into the molecular mode of orientin’s action in heart disease.

 Materials and methods Animals and treatments

Male C57BL/6 mice (18 to 20 g; Beijing Vital River Laboratory) were housed under standard conditions (humidity of 60%; temperature at 25±1°C; 12-h light/dark cycle). All experimental procedures were approved by the Animal Research and Use Committee of Wuhan Myhalic Biotechnology Co., Ltd (HLK-20240516003-003; July 18, 2024).

The DCM model was established with a high-fat diet (Research Diet D12492) for 28 days, followed by fasting overnight and intraperitoneal injection with streptozotocin (50 mg/kg × 5 days; 60256ES60; Shanghai Yeasen Biotechnology) dissolved in sodium citrate buffer (pH 4.5). After 7 days, animals with hyperglycemia (blood glucose≥16.7 mmol/L) were considered DM mice31 and continued to be fed a high-fat diet. Control mice were injected with sodium citrate buffer (pH 4.5) and fed a normal diet. Mice were divided into 5 groups (n=8 per group): control (control mice treated with normal saline); DM (DM mice treated with normal saline); DM + Orientin (10 mg/kg) (DM mice treated with 10 mg/kg orientin, MBS5750979; MyBiosource, Inc.); DM + Orientin (20 mg/kg) (DM mice treated with 20 mg/kg orientin); DM + Orientin (40 mg/kg) (DM mice treated with 40 mg/kg orientin). Orientin was intraperitoneally administered once daily (dissolved in DMSO; a volume of 50 μl). All experimental groups were treated for 12 weeks.

 Echocardiography

Mice were anesthetized with 0.5% isoflurane, and their chests were shaved. M-mode echocardiography was performed to evaluate mouse cardiac function using a High-Resolution Micro-Imaging System (VeVo 770; VisualSonics Inc.). Echocardiography parameters, including left ventricular diastolic diameter (LVEDD), systolic diameter (LVEDS), ejection fraction (LVEF), and fractional shortening (LVFS) were measured. All measurements were averaged from 5 continuous cardiac cycles.

 Heart index

Mice were weighed and euthanized via CO2 inhalation. The chest cavity was opened, and the heart was perfused with 0.1 M KCl. After the heart stopped beating, the residual blood inside was removed with saline. Then, the heart was excised and washed three times. The heart was dried on filter paper and weighed.

 Histology

Mouse heart tissue was fixed in 10% formalin (Top0372; Beijing Biotopped Life Sciences), dehydrated, and embedded in paraffin. The tissue was cut into 5 μm sections, placed on glass slides, and stained with hematoxylin-eosin (H&E; RS3390; Beijing G-Clone Biotechnology) using the standard method. Masson’s trichrome staining (RS3960l; Beijing G-Clone Biotechnology) was used to estimate collagen deposition and fibrosis in the heart. Pathological changes were observed under an Olympus CKX41 microscope. Five fields per heart section were analyzed using Image-Pro Plus 6.0.

 Detection of lactate dehydrogenase (LDH), creatine kinase-MB, and troponin (cTnI)

Blood samples were obtained from the inner canthus of the mouse eyes and centrifuged at 3,000×g for 15 min at 4°C. Cardiac injury indicators, including LDH, CK-MB, and cTnI in serum, were measured using Mouse LDH ELISA Kit (ZK-M4619; Shenzhen Ziker Biotechnology), CK-MB ELISA Kit (ZK-M4805; Shenzhen Ziker Biotechnology), and cTnI ELISA Kit (JYM0409Mo; Wuhan Jiyinmei Biotechnology), respectively, following the manufacturer’s protocols.

 TUNEL staining

To detect cardiac cell death, the TUNEL assay was performed using the TUNEL FITC Apoptosis Detection Kit (A111-01; Nanjing Vazyme Biotechnology) following the manufacturer’s instructions. Nuclei were labeled with DAPI (40727ES10; Shanghai Yeasen Biotechnology). Images were obtained using a Leica SP8 confocal microscope. Five fields per heart section were analyzed using Image-Pro Plus 6.0.

 Cells and treatments

HL-1 mouse cardiomyocytes (ml096513; Shanghai mlbio) were incubated in DMEM containing 10% FBS and 100 U/ml penicillin-streptomycin under 5% CO2/95% air at 37°C. When cells reached 70%-80% confluence, they were exposed to normal glucose (5.5 mmol/L) or high glucose (33 mmol/L) or/and orientin (2.5-20 μM) for 24 h. To explore the protective mechanisms of orientin, cells were treated with 10 μM LY294002 (an inhibitor of PI3K; BES250679D; Shanghai BIOSEN Biotechnology) 2 h before orientin treatment.

 Transfection

HL-1 mouse cardiomyocytes were transfected with the H19 overexpression vector pcDNA3.1/H19 (H19), miR-103-3p, or siRNA targeting ALDH2 (si-ALDH2) (all from Shanghai GenePharm Biotechnology) using Lipofectamine 2000 (168019; Thermo Fisher Scientific, Inc.) following the manufacturer’s protocols. Empty vector (vector), NC mimic, and si-NC acted as negative controls. Changes in RNA and protein expressions were detected using qPCR and western blot 48 h after transfection.

 CCK-8 assay

HL-1 cardiomyocytes were seeded in 96-well plates (0.8-1×103 cells/well) overnight and treated with high glucose (33 mmol/L) or/and orientin (2.5-20 μM) for 24 h. Then, 10 µL CCK-8 (40203ES60; Shanghai Yeasen Biotechnology) at a concentration of 5 mg/mL was added to each well. After cells were cultured for 3-4 h at 37°C, absorbance at 450 nm was measured using an SMR16.1 Smart Microplate Reader (Wuhan USCNK IT LIFE SCIENCE INC.).

 Detection of glutathione (GSH), superoxide Dismutase (SOD), 4-hydroxynonenal (4-HNE), and malondialdehyde (MDA)

After 0.1g frozen heart tissue was homogenized with 1 mL distilled water, the tissue homogenate was centrifuged at 12,000 rpm for 15 min. HL-1 cells were washed with PBS (pH 7.2) and homogenized in PBS containing 0.5 mM butylated hydroxytoluene. The homogenate was centrifuged at 3,000×g for 15 min at 4°C. Glutathione (GSH), superoxide Dismutase (SOD), 4-hydroxynonenal (4-HNE), malondialdehyde (MDA), and ROS in the supernatant were detected using Mouse GSH ELISA Kit (BLL-yx2756; Shanghai Baililai Biotechnology), SOD ELISA Kit (BLL-yx3040; Shanghai Baililai Biotechnology), 4-HNE ELISA Kit (YS03024B; Shanghai Yaji Biotechnology), MDA ELISA Kit (BLL-yx3039; Shanghai Baililai Biotechnology), and ROS Assay Kit (DCFH-DA; S0033; Shanghai Beyotime Biotechnology), respectively, following the manufacturer’s protocols. The ROS levels were detected by flow cytometry.

 RT-qPCR

Total RNAs were isolated from heart tissue and HL-1 cells using Total RNA Extractor (zk3074; Shenzhen Zike Biotechnology) and reversely transcribed into cDNA using HiFiScript cDNA Synthesis Kit (AD502A; Shanghai Proteinssci Biotechnology) following the supplier’s protocols. The PCR reaction was performed with Power SYBR Green PCR Master Mix (Applied Biosystems) on a 7900HT Fast Real-Time PCR System (Applied Biosystems). Gene expression was calculated using the threshold cycle method, which was normalized to GAPDH or U6. Primer sequences used for RT-qPCR are shown in Table 1.

– Primer sequences used for RT-qPCR
Target (mouse) Primer sequences (5´-3´)
H19 F: CATTCTAGGCTGGGGTCAAA
H19 R: GCCCTTCTTTTCCATTCTCC
miR-103-3p F: ACACTCCAGCTGGGAGCAGCATTGTAC
miR-103-3p R: TGGTGTCGTGGAGTCG
ALDH2 F: GCTGTTGTACCGATTGGCGGAT
ALDH2 R: GCGGAGACATTTCAGGACCATG
GAPDH F: TGCACCACCAACTGCTTAG
GAPDH R: GGATGCAGGGATGATGTTC
U6 F: CTCGCTTCGGCAGCACA
U6 R: AACGCTTCACGAATTTGCGT

Western blot

Isolation of total proteins and western blot analysis were conducted as described by Liu et al. 32. Primary antibodies included Bax (ab32503; 1:1500; Abcam), cleaved caspase3 (#AF7022; 1:1500; affinity), Bcl-2 (ab182858; 1:2000; Abcam), ALDH2 (#DF6358; 1:1500; affinity), p-PI3K (#AF3241; 1:1500; affinity), PI3K (#AF6241; 1:1500; affinity), p-AKT (#AF0016; 1:1500; affinity), AKT (#AF6261; 1:1500; affinity), and GAPDH (#AF7021; 1:15000; affinity). Protein bands were captured by enhanced chemiluminescence substrate (ES-0006; Wuhan FineTest Biotechnology). Densitometry analysis was performed using Image-Pro Plus 6.0.

 Luciferase reporter assay

Wild type (Wt) or mutant (Mut) fragment of H19 and ALDH2 3’UTR containing the predicted binding sites of mmu-miR-103-3p was inserted into the Promega pmirGLO vector to construct the plasmids including H19-Wt/Mut and ALDH2-Wt/Mut, respectively. HL-1 cells were seeded into 24-well plates and transfected with these luciferase reporter plasmids together with miR-103-3p mimic or NC mimic using Lipofectamine 2000. At 48 h, luciferase activity was determined using the Promega Luciferase Reporter Assay Kit.

 Statistical analysis

The normality of data distribution was verified using the Shapiro-Wilk test (p>0.05 for all groups). All values are shown as means ± standard deviation. One/two-way ANOVA with a Tukey’s test was used to determine significant differences between groups. P<0.05 was considered statistically significant. All analyses were performed in SPSS v.21.0 software. Each experiment was repeated three times. For animal studies, the sample size was determined by statistical power analysis (targeting 80% power to detect a 30% change in primary endpoints at α=0.05).

 Results Orientin ameliorates heart injury in DM mice

As shown in Table 2, compared to the control group, the DM group exhibited higher blood glucose levels, heart weight, and body weight (p<0.05). Orientin had no impact on blood glucose levels and body weight. Compared to the DM group, orientin at doses of 20 and 40 mg/kg significantly reduced heart weight in mice (p<0.05). M-mode echocardiography data in Table 3 indicated that LVEF and LVFS were reduced, and LVEDD and LVEDS were markedly increased in diabetic mice compared to control mice (p<0.05). Orientin at doses of 20 and 40 mg/kg elevated LVEF and reduced LVEDD, and orientin at a dose of 40 mg/kg elevated LVFS and reduced LVEDS (p<0.05). H&E staining of the cardiac section in the control group exhibited normal morphology of cardiomyocytes and regular myocardial fibers. However, myocardial tissue in the DM group showed obvious disordered architecture of cardiomyocytes and myocardial hypertrophy compared to the control group. Orientin (20 and 40 mg/kg) ameliorated a majority of pathological changes (Figure 1A). Serum activities of LDH, CK-MB, and cTnI, important indicators of heart injury, were estimated. Data indicated that serum activities of these indicators were notably enhanced in diabetic mice compared to control mice. Orientin at doses of 20 and 40 mg/kg significantly restored their activities compared to diabetic mice (Figure 1B-D). Masson staining showed significant collagen deposition in the heart of DM mice, which was ameliorated by orientin administration (Figure 1E-F).

– Effects of orientin on blood glucose, heart weight, and body weight in diabetic mice
Indexes Control DM DM + Orientin (10 mg/kg) DM + Orientin (20 mg/kg) DM + Orientin (40 mg/kg)
Blood glucose (mM) 8.24±1.14 22.31±1.78* 21.95±1.97 20.77±2.54 22.45±2.64
Heart weight (mg) 111.25±9.14 138.67±11.09* 129.98±12.73 118.62±9.14# 120.08±8.98#
Body weight (g) 27.54±1.24 36.78±2.89* 35.22±1.79 36.02±3.11 37.15±2.52

All values are shown as means ± standard deviation and analyzed using one-way ANOVA. N=8 per group. *p<0.05 vs control group; #p<0.05 vs DM group. DM: diabetes mellitus

– Effects of orientin on left ventricular functions in diabetic mice
Indexes Control DM DM + Orientin (10 mg/kg) DM + Orientin (20 mg/kg) DM + Orientin (40 mg/kg)
LVEF% 61.91±3.25 38.57±2.37* 39.45±3.05 42.67±2.90# 53.74±3.75#
LVFS% 31.57±1.76 17.98±1.38* 19.64±1.12 19.99±1.24 25.86±1.47#
LVEDD (mm) 3.86±0.34 4.77±0.27* 4.61±0.66 4.06±0.86# 3.99±0.25#
LVEDS (mm) 2.61±0.11 3.68±0.41* 3.44±0.66 3.38±0.14 2.76±0.09#

All values are shown as means ± standard deviation and analyzed using one-way ANOVA. N=8 per group. *p<0.05 vs control group; #p<0.05 vs DM group. DM: diabetes mellitus; LVEDD: left ventricular diastolic diameter; LVESD: left ventricular systolic diameter; LVEF: left ventricular ejection fraction; LVSF: left ventricular fractional shortening.

– Orientin ameliorates heart injury in DM mice. (A) Histological changes measured by H&E staining. Scale bar=50 μm. (B-D) Effects of orientin on serum activities of LDH, CK-MB, and cTnI in DM mice. One-way ANOVA. (E-F) Masson staining of heart section and quantitative analysis. Scale bar=50 μm. One-way ANOVA. N=8 per group. ***p<0.01 vs control group; #p<0.05, ##p<0.01, ###p<0.001 vs DM group<italic>.</italic>

Orientin alleviates myocardial apoptosis and oxidative stress in DM mice

Since 40 mg/kg, orientin showed the best cardioprotective effects, we used this dose in subsequent experiments. The DM group exhibited a higher number of TUNEL-positive cardiomyocytes in the heart than the control group. Orientin administration reversed this trend and reduced cardiomyocyte apoptosis (Figure 2A-B). Orientin also restored the levels of apoptosis-related proteins in diabetic mice, as demonstrated by upregulated Bcl-2 and downregulated Bax and cleaved caspase3 in the orientin group compared to the DM group (Figure 2C-D). We evaluated the levels of oxidative stress-related parameters. Diabetic mice exhibited significant reductions in heart GSH and SOD activities and increases in MDA and 4-HNE levels compared to the control group, which were notably restored by orientin (Figure 2E-H).

– Orientin alleviates myocardial apoptosis and oxidative stress in DM mice. (A-B) TUNEL staining of the heart section and quantitative analysis. Scale bar = 20 μm. One-way ANOVA. (C-D) Western blot data showing levels of apoptosis-related proteins in the mouse hearts. One-way ANOVA. (E-H) GSH and SOD activities, as well as MDA and 4-HNE levels in mouse hearts. One-way ANOVA. N=8 per group. ***p<0.01 vs control group; ##p<0.01, ###p<0.001 vs DM group.

Effects of orientin on the H19/miR-103-3p/ALDH2/PI3K/AKT axis in DM mice

RT-qPCR data showed that, in diabetic mice, H19 and ALDH2 in the myocardium were notably downregulated, whereas miR-103-3p was upregulated, compared to control mice. Their expression levels were restored after orientin treatment (Figure 3A). Additionally, protein levels of ALDH2 and phosphorylated PI3K and AKT were markedly lower in the DM group than in the control group, which were reversed in the orientin-treated group (Figure 3B-C).

– Effects of orientin on the H19/miR-103-3p/ALDH2/PI3K/AKT axis in DM mice. (A) RT-qPCR data showing H19, miR-103-3p, and ALDH2 expressions in mouse hearts. One-way ANOVA. (B-C) Western blot showing levels of ALDH2 and phosphorylated PI3K and AKT in mouse hearts. One-way ANOVA. N=8 per group. ***p<0.01 vs control group; ###p<0.001 vs DM group.

Orientin reduces high glucose-triggered oxidative stress and apoptosis in HL-1 cells

CCK-8 results indicated that orientin at doses of 2.5- 20 μM did not influence HL-1 cell viability (Figure 4A). Orientin at doses of 5, 10, and 20 μM rescued HL cell viability suppressed by high glucose (Figure 4B), and 10 μM orientin showed the most significant effects. We used 10 μM orientin in subsequent experiments. As presented in Figure 4C-F, high glucose enhanced ROS and MDA levels and decreased SOD activities, which were reversed by orientin pretreatment. Orientin pretreatment restored protein levels of Bax, Bcl-2, cleaved caspase3, ALDH2, and phosphorylated PI3K and AKT in high glucose-treated HL-1 cardiomyocytes (Figure 4G-H). Additionally, reduced expressions of H19 and ALDH2 and increased expression of miR-103-3p in high glucose-treated HL-1 cells were reversed by orientin pretreatment (Figure 4I).

– Orientin reduces high glucose-triggered oxidative stress and apoptosis in HL-1 cells. (A-B) HL-1 cell viability after orientin or/and high glucose treatment measured by CCK-8. One-way ANOVA. (C-F) Effects of orientin on ROS and MDA levels and SOD activities in HL-1 cells. One-way ANOVA. (G-H) Western blot showing levels of Bax, Bcl-2, cleaved caspase3, ALDH2, and phosphorylated PI3K and AKT in HL-1 cardiomyocytes. One-way ANOVA. (I) RT-qPCR data showing H19, miR-103-3p, and ALDH2 expressions in HL-1 cardiomyocytes. One-way ANOVA. N=3 per group. ***p<0.01 vs control group; ###p<0.001 vs DM group.

The H19/miR-103-3p/ALDH2 axis regulates oxidative stress and apoptosis in HL-1 cells

The binding sites where H19 or ALDH2 interacts with miR-103-3p are shown in Figure 5A. The H19/ALDH2 sequence or its mutant version was co-transfected into HL-1 cells with miR-103-3p mimic. Data indicated significant decreases in luciferase activities following co-transfections with H19-Wt or ALDH1-Wt and miR-103-3p mimic, whereas co-transfections with H19-Mut or ALDH1-Mut and miR-103-3p mimic did not alter luciferase activities (Figure 5B). We found that overexpressing H19 restored protein levels of Bax, Bcl-2, cleaved caspase3, ALDH2, and phosphorylated PI3K and AKT in high glucose-treated HL-1 cardiomyocytes, which were reversed by miR-103-3p overexpression or ALDH2 depletion (Figure 5C-D). Additionally, H19 overexpression inhibited high glucose-triggered ROS production in HL-1 cells, but miR-103-3p overexpression or ALDH2 depletion negated the effects of H19 overexpression (Figure 5E).

– The H19/miR-103-3p/ALDH2 axis regulates oxidative stress and apoptosis in HL-1 cells. (A) Diagram depicting the binding sites between H19/ALDH2 and miR-103-3p. (B) Luciferase reporter assay showing luciferase activities following co-transfections with H19-Wt/Mut or ALDH1-Wt/Mut and miR-103-3p mimic. Two-way ANOVA. ***p<0.01 vs. NC mimic group. (C-D) Western blot showing levels of Bax, Bcl-2, cleaved caspase3, ALDH2, and phosphorylated PI3K and AKT in HL-1 cardiomyocytes. One-way ANOVA. (E) ROS levels in HL-1 cardiomyocytes. One-way ANOVA. N=3 per group. ***p<0.01 vs control group; ###p<0.001 vs HG + Vector + NC mimic + si-NC group; &&&p<0.001 vs HG + H19 group.

H19 depletion or PI3K inhibitor reverses the effects of orientin in HL-1 cells

For the rescue experiments, HL-1 cardiomyocytes under high glucose conditions were treated with orientin or/and with H19 depletion or PI3K inhibitor (LY294002). Results showed that the changes in the levels of Bax, Bcl-2, cleaved caspase3, ALDH2, and phosphorylated PI3K and AKT caused by orientin treatment were notably reversed by H19 knockdown or LY294002 treatment (Figure 6A-B). Furthermore, the H19 knockdown or LY294002 treatment counteracted the effects of orientin on ROS and MDA levels and SOD activities in high glucose-treated HL-1 cells (Figure 6C-E).

– H19 depletion or PI3K inhibitor reverses the effects of orientin in HL-1 cells. (A-B) Western blot showing levels of Bax, Bcl-2, cleaved caspase3, ALDH2, and phosphorylated PI3K and AKT in HL-1 cardiomyocytes. One-way ANOVA. (C-E) ROS and MDA levels and SOD activities in HL-1 cells. One-way ANOVA. N=3 per group. ***p<0.01 vs control group; ###p<0.001 vs HG group; &&&p<0.001 vs HG + Orientin group.

Discussion

In this study, orientin treatment alleviated deteriorated cardiac function in mice with DCM and protected against diabetes-induced cardiac fibrosis, apoptosis, and oxidative stress. Mechanistically, orientin restored the changes in the levels of H19, miR-103-3p, and ALDH2, as well as the PI3K/AKT pathway caused by hyperglycemia. This investigation, for the first time, reveals that the H19/miR-103-3p/ALDH2/PI3K/AKT axis has a key role in the cardioprotective action of orientin in DCM.

Orientin has been proposed as a promising compound for the treatment of cardiovascular disease. Orientin can exert antioxidant and antiapoptotic effects in ox-LDL-treated vascular endothelial cells and might protect against atherosclerosis.33 Orientin decreases inflammatory response, fibrosis, and cardiomyocyte apoptosis in mice following myocardial infarction. Additionally, orientin mitigates apoptosis and oxidative stress in cardiomyocytes exposed to hypoxia.25,26 Macrovascular complications of diabetes, including DCM, occur through multiple hyperglycemia-induced mechanisms in which oxidative stress has a central role.34 Cardiac oxidative stress is associated with reduced cardiac performance and contractility and increased cardiac fibrosis and hypertrophy, resulting in severe cardiac dysfunction and deadly cardiac events.35 Persistent hyperglycemia-mediated oxidative stress can activate apoptotic signaling in the heart to induce cardiomyocyte death.36,37 In this study, orientin did not influence blood glucose levels in DM mice. Still, it significantly ameliorated diabetes-induced cardiac dysfunction in mice independent of the modulation of blood glucose levels, possibly through inhibiting cardiac oxidative stress and apoptosis. M-mode echocardiography confirmed that orientin improved the hyperglycemia-induced cardiac dysfunction. Morphological and staining analyses further demonstrated that orientin ameliorated diabetes-induced cardiac tissue damage. LDH, CK-MB, and cTnI are key biochemical markers that reflect the degree of cardiac injury.38 Here, orientin markedly decreased LDH, CK-MB, and cTnI levels in the serum of DM mice.

The lncRNA-miRNA-mRNA ceRNA network has been reportedly involved in the regulation of the pathological processes of DCM.39-41 H19, a lncRNA abundant in the cardiovascular system, acts as a ceRNA to play a role in diabetes-related complications.42,43 Additionally, H19 is emerging as a potentially important regulator of cardiac disease.44 As reported, H19 overexpression improves left ventricular dysfunction in DM by reducing cardiomyocyte apoptosis and fibrosis.14 Shengjie Tongyu decoction protects against diabetic cardiac injury through upregulation of H19.45 Although it has been reported that orientin confers cardioprotection at the protein level, whether orientin could modulate the ceRNA network has not been investigated. Here, we confirmed that orientin restored H19 expression and decreased miR-103-3p expression in vivo and in vitro. H19 could bind to miR-103-3p as a sponge. miR-103-3p belongs to the miR-103/107 family and has been reported to increase cardiomyocyte programmed necrosis in myocardial ischemic injury.46

Additionally, miR-103-3p promotes hypertrophy and ROS production in the heart failure model.47 The effects of miR-103-3p in DCM are unknown. Here, we demonstrated that miR-103-3p negated the inhibitory effects of H19 overexpression on apoptosis and oxidative stress in HL-1 cells under high glucose conditions. Additionally, H19 could upregulate ALDH2, a target of miR-103-3p, in high glucose-treated HL-1 cells. Yu et al. demonstrated that ALDH2 is a crucial mediator in the cardioprotection of remote ischemic postconditioning through the PI3K/AKT-dependent pathway.48 ALDH2 alleviates ischemic injury in DCM through activation of the PI3K/AKT pathway.19 We found that the effects of H19 on the levels of apoptosis- and ALDH2/PI3K/AKT-related protein under high glucose conditions were reversed by miR-103-3p overexpression or ALDH2 knockdown, suggesting that H19 may activate the ALDH2/PI3K/AKT pathway by competing with miR-103-3p. It is noteworthy that orientin could upregulate ALDH2 expression in cardiomyocytes with high glucose. The effects of orientin on cardiomyocyte apoptosis and oxidative stress were reversed by H19 siRNA or an inhibitor of PI3K, demonstrating the key role of the H19/miR-103-3p/ALDH2/PI3K/AKT axis in the cardioprotective action of orientin.

Despite these findings, several limitations warrant consideration. Firstly, our in vivo model employed streptozotocin-induced diabetic mice fed a high-fat diet. While this replicates key features of human DCM, it does not fully capture the complexity of type 2 diabetes pathophysiology, including gradual β-cell dysfunction. Secondly, the study focused on the H19/miR-103-3p/ALDH2/PI3K/AKT axis as the primary mechanistic pathway; other signaling cascades or noncoding RNAs may contribute to orientin’s cardioprotective effects. Thirdly, long-term safety and pharmacokinetics of orientin in diabetic models remain unexplored. Future studies using genetic diabetes models, multi-omics approaches, and chronic toxicity assessments would strengthen clinical translation.

 Conclusion

In conclusion, our study demonstrates that orientin ameliorates DCM by attenuating oxidative stress and apoptosis through the H19/miR-103-3p/ALDH2/PI3K/AKT signaling axis. This work not only reveals a novel molecular mechanism for orientin’s cardioprotective effects but also identifies H19 and ALDH2 as potential therapeutic targets for DCM. Given orientin’s natural origin, these findings support its translational promise as a complementary strategy against diabetes-induced cardiac complications.

This study is not associated with any thesis or dissertation work.

This study was approved by the Ethics Committee of the Wuhan Myhalic Biotechnology Co., Ltd under the protocol number HLK-20240516003-003. All the procedures in this study were in accordance with the 1975 Helsinki Declaration, updated in 2013.

The authors did not use any artificial intelligence tools in the development of this work.

All datasets supporting the results of this study are available upon request from the corresponding author Jun Li.

For additional information, please click here.

This study was funded by Wuhan Municipal Health Commision (WZ241346).