Arq Bras CardiolabcArquivos Brasileiros de CardiologiaArq. Bras. Cardiol.0066-782X1678-4170Sociedade Brasileira de Cardiologia - SBCs59ZKn3JhjLWzJcWNjwKmpDS0066-782X20230004003070030710.36660/abc.20210933Artigo OriginalSLC26A4-AS1 Agrava a Hipertrofia Cardíaca Induzida por AngII Aumentando a Expressão de SLC26A4HanXiaoliangOs autores contribuíram igualmente para este trabalhoConcepção e desenho da pesquisa10000-0002-7366-2246LiChaoOs autores contribuíram igualmente para este trabalhoConcepção e desenho da pesquisaObtenção de financiamento e Redação do manuscrito2JiQinjiongObtenção de dados e Análise e interpretação dos dados1ZhangLingObtenção de dados e Análise e interpretação dos dados1XieXiaofeiObtenção de dados e Análise e interpretação dos dados1ShangHuijuanAnálise estatística e Revisão crítica do manuscrito quanto ao conteúdo intelectual importante1YeHongAnálise estatística e Revisão crítica do manuscrito quanto ao conteúdo intelectual importante1Departamento de CardiologiaInstituto de Controle de Tuberculose de AnhuiHefeiAnhuiChinaDepartamento de Cardiologia, Anhui Provincial Chest Hospital, (Instituto de Controle de Tuberculose de Anhui), Hefei, Anhui – ChinaDepartamento de CardiologiaHospital HefeiMedical University of AnhuiHefeiAnhuiChinaDepartamento de Cardiologia, the Second People’s Hospital of Hefei (Hospital Hefei afiliado à Medical University of Anhui), Hefei, Anhui – China Correspondência: Chao Li • The Second People’s Hospital of Hefei (Hefei Hospital Affiliated to Medical University of Anhui), Hefei, 230011, Anhui – China E-mail: vnqi46@163.com
Potencial conflito de interesse
Não há conflito com o presente artigo.
2104202320231204e20210933121120211810202215122022 This is an Open Access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. ResumoFundamento
Foi relatado que o RNA 1 antisenso 1 (SLC26A4-AS1) do membro 4 da família de transportadores de soluto 26 está altamente relacionado à hipertrofia cardíaca.
Objetivo
Esta pesquisa visa investigar o papel e o mecanismo específicos de SLC26A4-AS1 na hipertrofia cardíaca, fornecendo um novo marcador para o tratamento da hipertrofia cardíaca.
Métodos
Angiotensina II (AngII) foi infundida em cardiomiócitos ventriculares (NMVCs) de camundongos neonatos para induzir hipertrofia cardíaca. A expressão gênica foi detectada por PCR quantitativo em tempo real (RT-qPCR). Os níveis de proteína foram avaliados por western blot. Ensaios funcionais analisaram o papel de SLC26A4-AS1. O mecanismo de SLC26A4-AS1 foi avaliado por imunoprecipitação de proteína de ligação a RNA (RIP), pull-down de RNA e ensaios de luciferase repórter. O valor de p < 0,05 foi identificado como significância estatística. O teste t de Student avaliou a comparação dos dois grupos. A diferença entre os diferentes grupos foi analisada por análise de variância (ANOVA) de uma via.
Resultados
SLC26A4-AS1 é regulado para cima em NMVCs tratados com AngII e promove hipertrofia cardíaca induzida por AngII. SLC26A4-AS1 regula o membro 4 da família de transportadores de soluto 26 (SLC26A4) por meio do funcionamento como um RNA endógeno competitivo (ceRNA) para modular o microRNA (miR)-301a-3p e o miR-301b-3p em NMVCs. SLC26A4-AS1 promove hipertrofia cardíaca induzida por AngII via regulação para cima de SLC26A4 ou absorção de miR-301a-3p/miR-301b-3p.
Conclusão
SLC26A4-AS1 agrava a hipertrofia cardíaca induzida por AngII via absorção de miR-301a-3p ou miR-301b-3p para aumentar a expressão de SLC26A4.
CardiomegaliaRNARNA Longo não CodificanteSecond People’s Hospital of Hefeijygh201926Fontes de financiamento: O presente estudo foi financiado por Second People’s Hospital of Hefei (No.jygh201926).Introdução
A hipertrofia cardíaca é uma resposta adaptativa para melhorar a pós-carga cardíaca para sustentar a função cardíaca sistólica nos estágios iniciais.1 Apesar disso, a hipertrofia miocárdica contínua é uma doença cardíaca típica induzida pelo aumento da carga de trabalho do coração acompanhada de remodelação cardíaca mal adaptativa, levando à estenose aórtica e cardiomiopatia dilatada.2,3 Paredes ventriculares excessivamente espessas e cardiomiócitos são os padrões primários de hipertrofia cardíaca.2,3 Nos últimos anos, a hipertrofia cardíaca tornou-se um problema urgente que pode levar a uma incidência crescente de insuficiência cardíaca e morte súbita.3
As características marcantes da hipertrofia cardíaca patológica são a elevação de genes fetais como o peptídeo natriurético cerebral (BNP), peptídeo natriurético atrial (ANP) e a cadeia pesada de beta-miosina (β-MHC).4 Estudos recentes provaram que muitos fatores, incluindo fatores de crescimento específicos, hormônios peptídicos e microRNAs (miRNAs), são responsáveis pela hipertrofia cardíaca,5 mas o mecanismo molecular exato subjacente à progressão da hipertrofia cardíaca permanece obscuro.
Os RNAs longos não codificantes (lncRNAs) participam de processos patológicos por meio do controle da expressão gênica nos níveis epigenético, transcricional e pós-transcricional.6 Evidências crescentes revelaram os papéis vitais dos lncRNAs no desenvolvimento de doenças cardiovasculares, incluindo a hipertrofia cardíaca.7 Por exemplo, o lncRNA SNHG14 induzido por SP1 promove hipertrofia cardíaca via rede miR-322-5p/miR-384-5p/PCDH17 em cardiomiócitos induzidos por angiotensina II (AngII).8 O silenciamento de LncRNA MIAT restringe a hipertrofia cardíaca induzida por AngII via eixo de RNA endógeno concorrente miR-93/TLR4 (ceRNA).9 O membro 4 da família LncRNA transportadora de soluto 26 RNA antisenso 1 (SLC26A4-AS1) foi relatada como altamente associada com hipertrofia cardíaca.10 No entanto, o efeito e o mecanismo regulador do SLC26A4-AS1 na hipertrofia cardíaca permanecem vagos.
Os miRNAs são outro tipo de RNA não codificante com um comprimento de cerca de 22 nucleotídeos.11 Os miRNAs geralmente exercem funções celulares por meio do direcionamento de RNAs mensageiros a jusante (mRNAs).12 Numerosos miRNAs têm sido apontados como reguladores essenciais na progressão da hipertrofia cardíaca.13 Por exemplo, o miR-17-5p facilita a hipertrofia cardíaca induzida por AngII por meio da inibição da expressão de Mfn2 e ativação do eixo PI3K/AKT/mTOR para suprimir a autofagia.14 O MiR-29a melhora a hipertrofia cardíaca induzida pelo cloridrato de isoproterenol ao reprimir a expressão do PPARδ.15 Considerando o papel vital dos miRNAs na hipertrofia cardíaca, tentamos investigar o mecanismo regulador do SLC26A4-AS1 focando nos miRNAs que interagem com ele.
No estudo atual, o efeito de SLC26A4-AS1 no nível de BNP, ANP e β-MHC foi explorado para determinar a função de SLC26A4-AS1 na hipertrofia cardíaca induzida por AngII. O mecanismo regulador de SLC26A4-AS1 foi investigado através do eixo ceRNA. Nosso estudo pode oferecer uma nova visão sobre os mecanismos fundamentais do lncRNA na hipertrofia cardíaca, fornecendo um novo alvo para o tratamento da hipertrofia cardíaca.
MétodosCultura celular e tratamento
Os cardiomiócitos foram isolados dos camundongos recém-nascidos. O comitê de ética do nosso Hospital aprovou experimentos com animais. Para induzir a hipertrofia dos cardiomiócitos, os corações extraídos foram partidos em pedaços e tratados com tripsina 0,25% (1/400, Beyotime, Shanghai, China), seguido de incubação em meio Eagle modificado por Dulbecco/F-12 (500mL, Thermo Fisher Scientific, Rockford, IL, EUA) com 10% FBS (1/10, Invitrogen, Carlsbad, CA, EUA). Após a confluência celular atingir 80%, as células nas placas foram transferidas para placas de cultura e inoculadas com AngII (150 nM, Sigma-Aldrich, St. Louis, MO, EUA) com a concentração de 150 nM para 1, 6, 12 e 24 h para estimular fenótipos hipertróficos de cardiomiócitos, estabelecendo o modelo celular de hipertrofia cardíaca.
Transfecção celular
Foram todos adquiridos da GenePharma Co., Ltd. (Shanghai, China) grampos curtos de RNA (shRNAs) contra SLC26A4-AS1 (sh-SLC26A4-AS1#1/2, 3ul/ug, GenePharma Co., Ltd., Xangai, China), shRNAs contra o membro 4 da família 26 de transportador de soluto (SLC26A4) (sh -SLC26A4#1/2, 3ul/ug, GenePharma Co., Ltd.), controle negativo de shRNA (sh-NC, 3ul/ug, GenePharma Co., Ltd.), pcDNA3.1-SLC26A4 (3ul/ug, GenePharma Co., Ltd.), vetor vazio pcDNA3.1 (pcDNA3.1, 3ul/ug, GenePharma Co., Ltd.), microRNA (miR)-301a-3p mimético (3ul/ug, GenePharma Co., Ltd. ), miméticos de miR-301b-3p (3ul/ug, GenePharma Co., Ltd.), controle negativo de miméticos de miRNA (miméticos de NC, 3ul/ug, GenePharma Co., Ltd.), inibidor de miR-301a-3p (3ul /ug, GenePharma Co., Ltd.), inibidor de miR-301b-3p (3ul/ug, GenePharma Co., Ltd.) e controle negativo do inibidor de miRNA (inibidor de NC, 3ul/ug, GenePharma Co., Ltd.). Todas as transfecções celulares foram aplicadas usando Lipofectamine 3000 (1,5ug/ml, Invitrogen), seguido pelo tratamento de 150 nM AngII por 24 h.
PCR quantitativo em tempo real (RT-qPCR)
O RNA total das células foi extraído pelo reagente TRIzol (1mL, Invitrogen). A concentração total de RNA foi determinada medindo o valor de absorção a 260 nm com um microespectrofotômetro. O RNA (1μl) foi transcrito reversamente para compor o DNA complementar usando a transcriptase reversa M-MLV (10000u, Promega, Madison, WI, EUA). Em seguida, a qPCR foi realizada com o kit SYBR Premix Ex Taq™ II (Takara, Japão). A expressão de miRNA foi normalizada para U6, e a de lncRNA e mRNA foi normalizada para gliceraldeído-3-fosfato desidrogenase (GAPDH), que foi baseado no método 2−ΔΔCt. A análise por RT-qPCR foi realizada conforme descrito anteriormente.16 Três ensaios independentes foram conduzidos. A sequência do iniciador para SLC26A4-AS1 e GAPDH é mostrada na Tabela 1.
– Sequência de iniciadores para SLC26A4-AS1 e GAPDH
Genes
Sequência
SLC26A4-AS1
F:TGCTGTTGCTGGAAAGCGAG R: TATTCCTTCCCGCGTGTCCT
GAPDH
F: GACAGTCAGCCGCATCTTCT R:GCGCCCAATACGACCAAATC
F: sequência direta; R: sequência reversa.
Western blot
Foi usado tampão de lise RIPA (100mL, Thermo Fisher Scientific) para extrair proteínas totais, e a concentração de proteína foi verificada usando um kit de ensaio de proteína BCA (Abcam, EUA). Após o tratamento de eletroforese em gel de poliacrilamida e dodecil sulfato de sódio (SDS-PAGE, 1/10, Invitrogen), as proteínas foram transferidas para membrana de PVDF (Millipore, EUA) e bloqueadas em leite desengordurado a 5%. Posteriormente, a membrana foi cultivada com anticorpos primários contra ANP (1µg/ml, ab237632, Abcam, Cambridge, MA, USA), BNP (1µg/ml, ab92500, Abcam), β-MHC (1/2500, ab55152, Abcam), SLC26A4 (0,25 µg/μl, 20889-1-AP, Proteintech, Chicago, EUA) e GAPDH (1/2500, ab8245, Abcam) a 4°C durante a noite. Após a lavagem, a membrana foi cultivada com anticorpo secundário conjugado com HRP (1/2500, Abcam) por 1 h. O sinal foi medido usando o substrato de western blotting de quimioluminescência melhorada. Todos os experimentos independentes foram repetidos três vezes.
Coloração de imunofluorescência (IF) e ensaio de área de superfície celular
As células foram lavadas e fixadas e bloqueadas com soro de cabra normal contendo 1% de BSA (1/100, Sigma-Aldrich). Posteriormente, as células foram cultivadas com anti-α-actinina (1/100, Sigma-Aldrich) a 4°C por uma noite inteira e foram incubadas com um anticorpo secundário por 1 h. DAPI (4’,6-diamidino-2-fenilindole, 1/2000, Abcam) foi aplicado para corar os núcleos, e um microscópio de fluorescência foi utilizado para capturar as imagens e avaliar a área de superfície celular. Três ensaios independentes foram conduzidos.
Fracionamento subcelular
Um kit PARIS (Thermo Scientific, EUA) foi usado para isolar as frações citoplasmática e nuclear de cardiomiócitos ventriculares (NMVCs) de camundongos neonatos. A expressão de GAPDH, U6 ou SLC26A4-AS1 no núcleo e no citoplasma foi avaliada por análise de RT-qPCR. Três ensaios independentes foram conduzidos.
Hibridação fluorescente in situ (FISH)
As sondas SLC26A4-AS1 marcadas com Alexa Fluor 555 (50 ng, RiboBio, Guangzhou, China) foram sintetizadas pela RiboBio (Guangzhou, China). Os experimentos FISH foram implementados com um kit FISH (RiboBio). As células foram semeadas em lâminas por 24 horas de incubação. Após fixação e permeabilização, as células foram cultivadas com sondas SLC26A4-AS1 a 37°C durante a noite. O DAPI foi utilizado para corar os núcleos das células e as imagens foram observadas em microscópio de fluorescência. Bio-repetições foram realizadas em triplicado.
Imunoprecipitação de proteínas de ligação ao RNA (RIP)
Com base nas instruções, o kit Magna RIP de imunoprecipitação de proteína de ligação a RNA (Millipore) e o anticorpo Ago2 (1/30, Abcam) foram usados para realizar ensaios RIP. Os RNAs coprecipitados foram analisados via RT-qPCR. Três ensaios independentes foram conduzidos.
Ensaio pull-down de RNA
Os NMVCs foram transfectados com uma sonda SLC26A4-AS1 biotinilada por 48 h. Em seguida, as células coletadas foram cultivadas com esferas magnéticas de estreptavidina M-280 (10 mg/ml, Invitrogen). Os RNAs ligados foram avaliados via RT-qPCR. Três ensaios independentes foram conduzidos.
Ensaio da luciferase repórter
A sequência de SLC26A4-AS1 ou SLC26A4 3’UTR contendo o local de ligação previsto com miR-301a-3p e miR-301b-3p foi clonada várias vezes no vetor de luciferase dupla pmirGLO (1 µg, Promega), bem como o vetor putativo e sequências mutantes. As células (3 × 104/poço) foram cultivadas em 24 placas poço para incubação. As células foram então transfectadas com esses plasmídeos repórteres e miméticos de miR-301a-3p ou miméticos de miR-301b-3p, respectivamente. Após 48 h de transfecção usando o reagente Lipofectamine 3000, um kit Dual-Luciferase Reporter Assay (Promega) foi aplicado para medir a atividade relativa da luciferase. Três ensaios independentes foram conduzidos.
Análise estatística
Todos os experimentos foram em triplicata e todos os experimentos independentes foram repetidos três vezes. O tamanho da amostra neste estudo foi definido pelo método de amostragem aleatória e calculado pela fórmula n=2σ2/δ2 f(α, β), onde δ é a diferença mínima, σ é o desvio padrão total, α é o nível de inspeção (= 0,05), e β é a taxa de erro tipo II (=0,10). Os dados foram apresentados como a média ± desvio padrão para 3 ensaios independentes. O software GraphPad Prism versão 5.0 foi aplicado para analisar os dados. A normalidade dos dados foi verificada por meio do teste de Shapiro-Wilk, que mostrou que todos os dados seguiram a distribuição normal. A significância estatística entre os grupos foi investigada pelo teste t de Student não pareado ou análise de variância unidirecional, seguido de um teste post hoc (Tukey e Dunnett). Além disso, um valor de p menor que 0,05 foi identificado como estatisticamente significativo.
ResultadosSLC26A4-AS1 é regulado para cima na hipertrofia de cardiomiócitos induzida por AngII
Para avaliar o papel específico de SLC26A4-AS1 na hipertrofia cardíaca, primeiro tratamos NMVCs com AngII para induzir fenótipos hipertróficos de cardiomiócitos. Os níveis de biomarcadores hipertróficos (ANP, BNP e β-MHC) em NMVCs tratados com AngII aumentaram gradualmente ao longo do tempo (Figura 1A-1C). A coloração mostrou que a área de superfície dos NMVCs tratados com AngII aumentou gradualmente ao longo do tempo (Figura 1D). Além disso, uma regulação para cima significativa de SLC26A4-AS1 em NMVCs também foi observada como dependente do tempo após o tratamento com AngII (Figura 1E). Em uma palavra, SLC26A4-AS1 é regulado para cima na hipertrofia de cardiomiócitos induzida por AngII.
– SLC26A4-AS1 é regulado para cima na hipertrofia cardíaca induzida por AngII. (A-C) Em NMVCs tratados com 150 nM AngII por 1, 6, 12 e 24 h, a expressão de biomarcadores hipertróficos (ANP, BNP e β-MHC) foi avaliada usando RT-qPCR, e o nível de proteína desses biomarcadores foi avaliada por western blot, seguida de quantificação por western blot. *P<0,05: AngII (1 h) vs AngII (0 h). *P<0,05: AngII (6 h) vs AngII (0 h). **P<0,01: AngII (12 h) vs AngII (0 h). **P<0,01: AngII (24 h) vs AngII (0 h). O número de tamanho da amostra (n) = 3. (D) A área de superfície celular em NMVCs tratadas com 150 nM AngII por 1, 6, 12 e 24 h foi avaliada usando coloração IF. Barra de escala: 10 μm. *P<0,05: AngII (1 h) vs AngII (0 h). *P<0,05: AngII (6 h) vs AngII (0 h). **P<0,01: AngII (12 h) vs AngII (0 h). **P<0,01: AngII (24 h) vs AngII (0 h). n = 3. (E) A expressão de SLC26A4-AS1 em NMVCs tratados com 150 nM AngII por 1, 6, 12 e 24 h foi detectada usando RT-qPCR. *P<0,05: AngII (1 h) vs AngII (0 h). *P<0,05: AngII (6 h) vs AngII (0 h). **P<0,01: AngII (12 h) vs AngII (0 h). **P<0,01: AngII (24 h) vs AngII (0 h). n = 3.
SLC26A4-AS1 facilita a hipertrofia cardíaca induzida por AngII
Além disso, a análise de RT-qPCR verificou a transfecção bem-sucedida de plasmídeos sh-SLC26A4-AS1#1/2 em NMVCs induzidos por AngII (Figura 2A). A área de superfície celular aumentada em NMVCs causada por AngII foi atenuada pelo silenciamento de SLC26A4-AS1 (Figura 2B). Enquanto isso, a expressão regulada para cima e o nível de proteína de ANP, BNP e β-MHC induzidos por AngII foram revertidos após o silenciamento de SLC26A4-AS1 (Figura 2C-2H). Esses resultados revelaram que SLC26A4-AS1 promove hipertrofia cardíaca induzida por AngII in vitro.
– O silenciamento de SLC26A4-AS1 suprime a hipertrofia cardíaca induzida por AngII. (A) NMVCs foram tratados com sh-SLC26A4-AS1#1/2 ou sh-NC após o tratamento de AngII por 24 h. **P<0,01: AngII vs Controle. **P<0,01: AngII+sh-SLC26A4-AS1#1/2 vs AngII+sh-NC. n = 3. (B) A área da superfície celular foi detectada em NMVCs tratados com AngII após o silêncio de SLC26A4-AS1 usando coloração IF. Barra de escala: 10 μm. **P<0,01: AngII vs Controle. **P<0,01: AngII+sh-SLC26A4-AS1#1/2 vs AngII+sh-NC. n = 3. (C-H) Após o silenciamento de SLC26A4-AS1, a expressão de biomarcadores hipertróficos em NMVCs tratados com AngII foi medida usando RT-qPCR, e o nível desses biomarcadores foi avaliado usando western blot, seguido pela quantificação de western blot. **P<0,01: AngII vs Controle. **P<0,01: AngII+sh-SLC26A4-AS1#1/2 vs AngII+sh-NC. n = 3.
SLC26A4-AS1 interage com SLC26A4, e SLC26A4 promove hipertrofia cardíaca induzida por AngII
O fracionamento subcelular e os ensaios de FISH foram implementados pela primeira vez para estudar o mecanismo potencial de SLC26A4-AS1 na hipertrofia cardíaca induzida por AngII. Descobrimos que SLC26A4-AS1 estava preferencialmente localizado no citoplasma celular, sugerindo o papel pós-transcricional de SLC26A4-AS1 em NMVCs tratados com AngII (Figura 3A-3B). Foi relatado que os lncRNAs podem regular seus genes próximos para exercer funções no desenvolvimento de doenças.17 Conforme mostrado na Figura Suplementar S3A, o banco de dados UCSC (http://genome.ucsc.edu/) previu que SLC26A4 era um gene próximo de SLC26A4-AS1. Portanto, conjecturamos que SLC26A4-AS1 pode regular SLC26A4 para afetar a hipertrofia cardíaca induzida por AngII. Em seguida, ensaios Ago2-RIP foram realizados para que Ago2 seja o componente central do complexo de silenciamento induzido por RNA. SLC26A4-AS1 e SLC26A4 foram altamente abundantes em precipitados ligados a anti-Ago2 (Figura 3C). RT-qPCR mostrou que a expressão de SLC26A4 foi significativamente elevada ao longo do tempo com o tratamento de AngII (Figura 3D). Além disso, o aumento da expressão e nível de proteína de SLC26A4 causado pelo tratamento com AngII foram diminuídos quando SLC26A4-AS1 foi silenciado (Figura 3E-3F). Em uma palavra, SLC26A4-AS1 interage com SLC26A4 em NMVCs.
– SLC26A4-AS1 funciona como um ceRNA para regular SLC26A4 na hipertrofia cardíaca induzida por AngII. (A-B) Fracionamento subcelular e ensaios de FISH foram realizados para determinar a localização de SLC26A4-AS1 em NMVCs induzidos por AngII. n = 3. (C) Ensaios RIP detectaram o enriquecimento de SLC26A4-AS1 e SLC26A4. **P<0,01: Ago2 vs IgG. n = 3. (D) A expressão de SLC26A4 em NMVCs tratados com 150 nM AngII por 1, 6, 12 e 24 h foi avaliada usando RT-qPCR. *P<0,05: AngII (1 h) vs AngII (0 h). *P<0,05: AngII (6 h) vs AngII (0 h). **P<0,01: AngII (12 h) vs AngII (0 h). **P<0,01: AngII (24 h) vs AngII (0 h). n = 3. (E-F) O nível de expressão e o nível de proteína de SLC26A4 em NMVCs tratados com AngII foram avaliados usando RT-qPCR e western blot, respectivamente, após regulação negativa de SLC26A4-AS1, seguido pela quantificação de western blot. **P<0,01: AngII vs Controle. **P<0,01: AngII+sh-SLC26A4-AS1#1/2 vs AngII+sh-NC. n = 3.
Para detectar a função de SLC26A4 na hipertrofia cardíaca induzida por AngII, foram realizados ensaios de perda de função após a verificação da eficiência de sh-SLC26A4#1/2 em NMVCs tratados com AngII ( Figura Suplementar S1A). A regulação para baixo de SLC26A4 reverteu o aumento da área de superfície de NMVCs tratados com AngII (Figura Suplementar S1B) e a regulação para cima dos níveis de biomarcadores hipertróficos estimulados pelo tratamento com AngII (Figura Suplementar S1C-S1H). Coletivamente, SLC26A4 promove hipertrofia cardíaca induzida por AngII in vitro.
SLC26A4-AS1 promove hipertrofia cardíaca induzida por AngII via regulação para cima de SLC26A4
Em seguida, a eficiência de pcDNA3.1-SLC26A4 foi certificada em NMVCs tratados com AngII (Figura 4A). Conforme mostrado na Figura 4B-4E, a área de superfície celular e os níveis de biomarcadores hipertróficos em NMVCs tratados com AngII foram obviamente reduzidos com a regulação para baixo de SLC26A4-AS1. No entanto, este efeito de inibição foi revertido após a co-transfecção de pcDNA3.1-SLC26A4. Tomados em conjunto, SLC26A4-AS1 promove hipertrofia cardíaca induzida por AngII através da regulação para cima de SLC26A4.
– SLC26A4-AS1 promove hipertrofia cardíaca induzida por AngII via regulação para cima de SLC26A4. (A) NMVCs introduzidos com pcDNA3.1-SLC26A4, ou pcDNA3.1 foram tratados com AngII por 24 h. **P<0,01: pcDNA3.1-SLC26A4 vs pcDNA3.1. Experimentos de resgate foram conduzidos em NMVCs com a transfecção de sh-NC, sh-SLC26A4-AS1#1, sh-SLC26A4-AS1#1+pcDNA3.1 e sh-SLC26A4-AS1#1+pcDNA3.1-SLC26A4 sob tratamento com AngII . n = 3. (B) A área da superfície celular foi avaliada em NMVCs tratados com AngII usando coloração IF. **P<0,01: AngII vs Controle. **P<0,01: AngII+sh-SLC26A4-AS1#1 vs AngII+sh-NC. **P<0,01: AngII+sh-SLC26A4-AS1#1+pcDNA3.1-SLC26A4 vs AngII+sh-SLC26A4-AS1#1+pcDNA3.1. n = 3. (C-E) O nível de expressão e o nível de proteína de biomarcadores hipertróficos em NMVCs tratados com AngII foram medidos por meio de RT-qPCR e western blot, respectivamente, seguidos pela quantificação de western blot. **P<0,01: AngII vs Controle. **P<0,01: AngII+sh-SLC26A4-AS1#1 vs AngII+sh-NC. **P<0,01: AngII+sh-SLC26A4-AS1#1+pcDNA3.1-SLC26A4 vs AngII+sh-SLC26A4-AS1#1+pcDNA3.1. n = 3.
SLC26A4-AS1 regula para cima SLC26A4 através do funcionamento como esponjas de miR-301a-3p ou miR-301b-3p
É bem reconhecido que os lncRNAs podem funcionar como concorrentes de RNAs endógenos (ceRNAs) para regular a expressão gênica por meio da interação com miRNAs em níveis pós-transcricionais.18 Seis miRNAs foram selecionados para determinar os miRNAs alvo combinados com SLC26A4-AS1 e SLC26A4 (Figura 5A). MiR-301a-3p e miR-301b-3p foram notavelmente abundantes no grupo bio-SLC26A4-AS1 em relação ao grupo bio-NC (Figura 5B). Além disso, SLC26A4-AS1, miR-301a-3p, miR-301b-3p e SLC26A4 foram todos marcadamente enriquecidos no grupo Ago2 (Figura 5C), indicando a presença de rede de ceRNA entre esses quatro RNAs. A RT-qPCR revelou que tanto o miR-301a-3p quanto o miR-301b-3p foram pouco expressos em NMVCs tratados com AngII de maneira dependente do tempo (Figura 5D-5E). Após a verificação da eficiência da superexpressão de miR-301a-3p ou miR-301b-3p (Figura Suplementar S2A-S2B), descobrimos que a área de superfície celular e os níveis de biomarcadores hipertróficos em NMVCs induzidos por AngII foram acentuadamente diminuídos por miR-301a -3p ou superexpressão de miR-301b-3p (Figura Suplementar S2C-S2F). Todos esses dados sugeriram que miR-301a-3p ou miR-301b-3p poderiam suprimir a hipertrofia cardíaca induzida por AngII in vitro.
– SLC26A4-AS1 regula para cima a expressão de SLC26A4 por meio de absorção de miR-301a-3p ou miR-301b-3p. (A) Os miRNAs candidatos combinados com SLC26A4-AS1 e SLC26A4 foram obtidos no site da starBase (http://starbase.sysu.edu.cn). (B) O enriquecimento relativo de miRNAs candidatos em grupos bio-SLC26A4-AS1 foi analisado por meio do ensaio de RNA pull-down. **P<0,01: Bio-SLC26A4-AS1 vs Bio-NC. n = 3. (C) O ensaio RIP detectou o enriquecimento relativo de SLC26A4-AS1, miR-301a-3p, miR-301b-3p e SLC26A4. **P<0,01: Ago2 vs IgG. n = 3. (D-E) A expressão de miR-301a-3p ou miR-301b-3p em NMVCs tratados com 150 nM AngII por 1, 6, 12 e 24 h foi detectada usando RT-qPCR. *P<0,05: AngII (1h)/AngII (6h) vs AngII (0 h). **P<0,01: AngII (12h)/AngII (24h) vs AngII (0 h). n = 3. (F) Ensaios de luciferase repórter foram implementados para detectar a atividade de luciferase de SLC26A4-AS1 do tipo selvagem (WT) ou do tipo mutante (MUT). **P<0,01: mímicos miR-301a-3p/mímicos miR-301b-3p vs mímicos NC. n = 3. (G) Ensaios de repórter de luciferase foram realizados para detectar a atividade de luciferase de SLC26A4 3’UTR WT ou MUT. **P<0,01: mímicos miR-301a-3p/mímicos miR-301b-3p vs miméticos NC. n = 3. (H) Os efeitos da superexpressão de miR-301a-3p ou miR-301b-3p na expressão de SLC26A4 foram avaliados via RT-qPCR. **P<0,01: AngII vs Controle. **P<0,01: miméticos AngII+miR-301a-3p/miméticos miR-301b-3p vs miméticos AngII+NC. n = 3.
Conforme mostrado na Figura Suplementar S3B, os respectivos locais de ligação dos dois miRNAs em SLC26A4-AS1 foram previstos a partir do banco de dados starBase. MiR-301a-3p ou miR-301b-3p superexpressos reduziram significativamente a atividade de SLC26A4-AS1 de tipo selvagem em vez de SLC26A4-AS1-MUT (Figura 5F). As sequências de ligação de miR-301a-3p ou miR-301b-3p em SLC26A4 3’UTR também foram mostradas na Figura Suplementar 3B. A atividade de luciferase de SLC26A4 3’UTR tipo selvagem foi diminuída em NMVCs induzidos por AngII após a superexpressão de miR -301a-3p ou miR-301b-3p (Figura 5G). Além disso, verificou-se que miméticos de miR-301a-3p ou miméticos de miR-301b-3p podem prejudicar a expressão de SLC26A4 em NMVCs induzidos por AngII (Figura 5H). Resumindo, SLC26A4-AS1 regula para cima a expressão de SLC26A4 servindo como um ceRNA para absorção de miR-301a-3p/miR-301b-3p.
SLC26A4-AS1 afeta a hipertrofia cardíaca induzida por AngII via absorção de miR-301a-3p ou miR-301b-3p
Para explorar se SLC26A4-AS1 afeta a hipertrofia cardíaca induzida por AngII por meio da regulação de miR-301a-3p/miR-301b-3p, primeiro inibimos a expressão de miR-301a-3p e miR-301b-3p em NMVCs induzidos por AngII (Figura 6A-6B). A área de superfície celular diminuída causada pelo silenciamento de SLC26A4-AS1 foi revertida após a cotransfecção do inibidor de miR-301a-3p ou do inibidor de miR-301b-3p (Figura 6C). Da mesma forma, a expressão inibida e o nível de proteína de biomarcadores hipertróficos induzidos pelo silenciamento de SLC26A4-AS1 foram neutralizados quando miR-301a-3p ou miR-301b-3p foram silenciados juntos (Figura 6D-6F). Tomados em conjunto, SLC26A4-AS1 afeta a hipertrofia cardíaca induzida por AngII por meio da absorção de miR-301a-3p ou miR-301b-3p in vitro.
– SLC26A4-AS1 afeta a hipertrofia cardíaca induzida por AngII via absorção de miR-301a-3p ou miR-301b-3p. (A-B) NMVCs tratados com inibidor de miR-301a-3p/inibidor de miR-301b-3p ou inibidor de NC foram tratados com AngII por 24 h. **P<0,01: inibidor de miR-301a-3p/inibidor de miR-301b-3p vs inibidor de NC. Experimentos de resgate foram conduzidos em NMVCs com a transfecção de sh-NC, sh-SLC26A4-AS1#1, sh-SLC26A4-AS1#1+inibidor de NC, sh-SLC26A4-AS1#1+miR-301a-3p inibidor e sh -SLC26A4-AS1#1+miR-301b-3p inibidor sob tratamento com AngII. n = 3. (C) A área da superfície celular foi medida em NMVCs tratados com AngII usando coloração IF. Barra de escala: 10 μm. **P<0,01: AngII vs Controle. **P<0,01: AngII+sh-SLC26A4-AS1#1 vs AngII+sh-NC. *P<0,05: AngII+sh-SLC26A4-AS1#1+inibidor de miR-301a-3p/inibidor de miR-301b-3p vs AngII+sh-SLC26A4-AS1#1+inibidor de NC. n = 3. (D-F) RT-qPCR e western blot avaliaram o nível de expressão e o nível de proteína de biomarcadores hipertróficos em NMVCs tratados com AngII, respectivamente, seguido pela quantificação de western blot. **P<0,01: AngII vs Controle. **P<0,01: AngII+sh-SLC26A4-AS1#1 vs AngII+sh-NC. *P<0,05: AngII+sh-SLC26A4-AS1#1+inibidor de miR-301a-3p/inibidor de miR-301b-3p vs AngII+sh-SLC26A4-AS1#1+inibidor de NC. n = 3.
Discussão
A hipertrofia cardíaca é dividida em hipertrofia fisiológica e patológica. A hipertrofia cardíaca patológica é o principal fator de indução para a progressão da insuficiência cardíaca com expressões anormais de genes cardíacos, morfologia cardíaca alterada e remodelamento cardíaco mal-adaptativo.19 Nos últimos anos, um grande número de pesquisas revelou que os lncRNAs são reguladores importantes na progressão de hipertrofia cardíaca patológica. O LncRNA PEG10 é regulado para cima em cardiomiócitos primários tratados com fenilefrina e exacerba a hipertrofia cardíaca induzida por fenilefrina através da modulação de HOXA9.20 O LncRNA TINCR melhora a hipertrofia cardíaca induzida por AngII através da regulação para baixo de CaMKII.21 O LncRNA TUG1 é regulado para cima em células H9c2 hipertróficas tratadas com AngII e promove Hipertrofia cardíaca induzida por AngII via interação com miR-29b-3p.22 No presente estudo, descobrimos que um novo lncRNA SLC26A4-AS1 está altamente associado à hipertrofia cardíaca10 e regulado para cima em cardiomiócitos hipertróficos induzidos por AngII. Além disso, o silenciamento de SLC26A4-AS1 prejudicou a área de superfície celular e o nível de ANP, BNP e β-MHC em cardiomiócitos hipertróficos induzidos por AngII. O SLC26A4-AS1 tem sido associado ao desenvolvimento de vários tipos de câncer, como carcinoma papilífero de tireoide23e glioma,24 mas seu papel e mecanismo potencial na hipertrofia cardíaca permanecem pouco claros. Nesta pesquisa, verificamos pela primeira vez a promoção de SLC26A4-AS1 na hipertrofia cardíaca induzida por AngII in vitro.
Outra descoberta desta pesquisa foi que SLC26A4-AS1 regula seu gene SLC26A4 próximo para afetar a hipertrofia cardíaca induzida por AngII. Foi relatado que SLC26A4 aumenta a hipertrofia cardíaca.25 Consistentemente com essa evidência, esta pesquisa confirmou que silenciar SLC26A4 suprime a hipertrofia cardíaca induzida por AngII. Além disso, a superexpressão de SLC26A4 poderia compensar o efeito supressor da depleção de SLC26A4-AS1 na hipertrofia cardíaca induzida por AngII.
Estudos recentes demonstraram que os lncRNAs podem funcionar pela rede de ceRNA para conduzir a hipertrofia cardíaca, na qual o lncRNA serve como uma esponja de miRNA para regular a expressão de mRNAs. Zhou et al. demonstraram que o lncRNA UCA1 facilita a progressão da hipertrofia cardíaca modulando competitivamente o miR-184 para afetar a expressão de HOXA9.26 Li et al. demonstraram que o lncRNA MIAT acelera a hipertrofia cardíaca induzida por AngII por meio da modulação de miR-93 e TLR4.9 Wo et al. descobriram que CHRF promove hipertrofia cardíaca induzida por isoproterenol visando miR-93 e Akt3.27 O estudo atual também demonstrou que SLC26A4-AS1 regula a expressão de SLC26A4 por meio do funcionamento como ceRNAs como esponja para miRNAs em um nível pós-transcricional. Depois de encontrar os miRNAs comuns de SLC26A4-AS1 e SLC26A4, revelamos que SLC26A4-AS1 regula SLC26A4 por meio do funcionamento como ceRNAs para esponja de miR-301a-3p ou miR-301b-3p.
Estudos anteriores descobriram que os miRNAs exercem funções vitais na hipertrofia cardíaca. O MiR-22 atua como um modulador vital da hipertrofia dos cardiomiócitos e da remodelação cardíaca.28 O MiR-625-5p reprime a hipertrofia cardíaca por meio da interação com CaMKII e STAT3.29 O MiR-29a facilita a hipertrofia cardíaca pela via PTEN/AKT/mTOR. MiR-301a-3p e miR-301b-3p também foram relatados como implicados em cânceres humanos, como carcinoma hepatocelular,30 câncer de pulmão de células não pequenas31 e câncer pancreático.32 No entanto, o papel supressor de miR-301a -3p e miR-301b-3p na hipertrofia cardíaca induzida por AngII foi comprovado pela primeira vez. Além disso, a inibição de miR-301a-3p ou miR-301b-3p pode reverter os efeitos repressivos do silenciamento de SLC26A4-AS1 na hipertrofia cardíaca induzida por AngII.
Conclusão
Em conclusão, esta pesquisa achou que SLC26A4-AS1 regula o eixo miR-301a-3p/miR-301b-3p/SLC26A4 para facilitar a hipertrofia cardíaca induzida por AngII, que lança luz sobre um biomarcador promissor para o tratamento da hipertrofia cardíaca. No entanto, o presente estudo foi realizado apenas em experimentos in vitro para investigar o efeito do SLC26A4-AS1 em cardiomiócitos, o que apresenta certas limitações. Para melhorar nossa compreensão do papel específico e do mecanismo subjacente do SLC26A4-AS1 na hipertrofia cardíaca, realizaremos experimentos in vivo e análise clínico-patológica do SLC26A4-AS1 na hipertrofia cardíaca em nossas pesquisas futuras.
Referências1. Nakamura M, Sadoshima J. Mechanisms of Physiological and Pathological Cardiac Hypertrophy. Nat Rev Cardiol. 2018;15(7):387-407. doi: 10.1038/s41569-018-0007-y.NakamuraMSadoshimaJMechanisms of Physiological and Pathological Cardiac HypertrophyNat Rev Cardiol201815738740710.1038/s41569-018-0007-y2. Lyon RC, Zanella F, Omens JH, Sheikh F. Mechanotransduction in Cardiac Hypertrophy and Failure. Circ Res. 2015;116(8):1462-76. doi: 10.1161/CIRCRESAHA.116.304937.LyonRCZanellaFOmensJHSheikhFMechanotransduction in Cardiac Hypertrophy and FailureCirc Res201511681462147610.1161/CIRCRESAHA.116.3049373. Shimizu I, Minamino T. Physiological and Pathological Cardiac Hypertrophy. J Mol Cell Cardiol. 2016;97:245-62. doi: 10.1016/j.yjmcc.2016.06.001.ShimizuIMinaminoTPhysiological and Pathological Cardiac HypertrophyJ Mol Cell Cardiol20169724526210.1016/j.yjmcc.2016.06.0014. Zhang C, Wang Y, Ge Z, Lin J, Liu J, Yuan X, et al. GDF11 Attenuated ANG II-Induced Hypertrophic Cardiomyopathy and Expression of ANP, BNP and Beta-MHC Through Down- Regulating CCL11 in Mice. Curr Mol Med. 2018;18(10):661-71. doi: 10.2174/1566524019666190204112753.ZhangCWangYGeZLinJLiuJYuanXet alGDF11 Attenuated ANG II-Induced Hypertrophic Cardiomyopathy and Expression of ANP, BNP and Beta-MHC Through Down- Regulating CCL11 in MiceCurr Mol Med2018181066167110.2174/15665240196661902041127535. Samak M, Fatullayev J, Sabashnikov A, Zeriouh M, Schmack B, Farag M, et al. Cardiac Hypertrophy: An Introduction to Molecular and Cellular Basis. Med Sci Monit Basic Res. 2016;22:75-9. doi: 10.12659/MSMBR.900437.SamakMFatullayevJSabashnikovAZeriouhMSchmackBFaragMet alCardiac Hypertrophy: An Introduction to Molecular and Cellular BasisMed Sci Monit Basic Res201622757910.12659/MSMBR.9004376. Gil N, Ulitsky I. Regulation of Gene Expression by Cis-Acting Long Non-Coding RNAs. Nat Rev Genet. 2020;21(2):102-17. doi: 10.1038/s41576-019-0184-5.GilNUlitskyIRegulation of Gene Expression by Cis-Acting Long Non-Coding RNAsNat Rev Genet202021210211710.1038/s41576-019-0184-57. Lv L, Li T, Li X, Xu C, Liu Q, Jiang H, et al. The lncRNA Plscr4 Controls Cardiac Hypertrophy by Regulating miR-214. Mol Ther Nucleic Acids. 2018;10:387-97. doi: 10.1016/j.omtn.2017.12.018.LvLLiTLiXXuCLiuQJiangHet alThe lncRNA Plscr4 Controls Cardiac Hypertrophy by Regulating miR-214Mol Ther Nucleic Acids20181038739710.1016/j.omtn.2017.12.0188. Long Y, Wang L, Li Z. SP1-Induced SNHG14 Aggravates Hypertrophic Response in in Vitro Model of Cardiac Hypertrophy via Up-Regulation of PCDH17. J Cell Mol Med. 2020;24(13):7115-26. doi: 10.1111/jcmm.15073.LongYWangLLiZSP1-Induced SNHG14 Aggravates Hypertrophic Response in in Vitro Model of Cardiac Hypertrophy via Up-Regulation of PCDH17J Cell Mol Med202024137115712610.1111/jcmm.150739. Li Y, Wang J, Sun L, Zhu S. LncRNA Myocardial Infarction-Associated Transcript (MIAT) Contributed to Cardiac Hypertrophy by Regulating TLR4 via miR-93. Eur J Pharmacol. 2018;818:508-17. doi: 10.1016/j.ejphar.2017.11.031.10.LiYWangJSunLZhuSLncRNA Myocardial Infarction-Associated Transcript (MIAT) Contributed to Cardiac Hypertrophy by Regulating TLR4 via miR-93Eur J Pharmacol201881850851710.1016/j.ejphar.2017.11.031.1010. Song C, Zhang J, Liu Y, Pan H, Qi HP, Cao YG, et al. Construction and Analysis of Cardiac Hypertrophy-Associated lncRNA-mRNA Network Based on Competitive Endogenous RNA Reveal Functional lncRNAs in Cardiac Hypertrophy. Oncotarget. 2016;7(10):10827-40. doi: 10.18632/oncotarget.7312.SongCZhangJLiuYPanHQiHPCaoYGet alConstruction and Analysis of Cardiac Hypertrophy-Associated lncRNA-mRNA Network Based on Competitive Endogenous RNA Reveal Functional lncRNAs in Cardiac HypertrophyOncotarget2016710108271084010.18632/oncotarget.731211. Bernardo BC, Ooi JY, Lin RC, McMullen JR. miRNA Therapeutics: A New Class of Drugs with Potential Therapeutic Applications in the Heart. Future Med Chem. 2015;7(13):1771-92. doi: 10.4155/fmc.15.107.BernardoBCOoiJYLinRCMcMullenJRmiRNA Therapeutics: A New Class of Drugs with Potential Therapeutic Applications in the HeartFuture Med Chem20157131771179210.4155/fmc.15.10712. Fabian MR, Sonenberg N, Filipowicz W. Regulation of mRNA Translation and Stability by MicroRNAs. Annu Rev Biochem. 2010;79:351-79. doi: 10.1146/annurev-biochem-060308-103103.FabianMRSonenbergNFilipowiczWRegulation of mRNA Translation and Stability by MicroRNAsAnnu Rev Biochem20107935137910.1146/annurev-biochem-060308-10310313. Ucar A, Gupta SK, Fiedler J, Erikci E, Kardasinski M, Batkai S, et al. The miRNA-212/132 Family Regulates Both Cardiac Hypertrophy and Cardiomyocyte Autophagy. Nat Commun. 2012;3:1078. doi: 10.1038/ncomms2090.UcarAGuptaSKFiedlerJErikciEKardasinskiMBatkaiSet alThe miRNA-212/132 Family Regulates Both Cardiac Hypertrophy and Cardiomyocyte AutophagyNat Commun20123107810.1038/ncomms209014. Xu X, Su YL, Shi JY, Lu Q, Chen C. MicroRNA-17-5p Promotes Cardiac Hypertrophy by Targeting Mfn2 to Inhibit Autophagy. Cardiovasc Toxicol. 2021;21(9):759-71. doi: 10.1007/s12012-021-09667-w.XuXSuYLShiJYLuQChenCMicroRNA-17-5p Promotes Cardiac Hypertrophy by Targeting Mfn2 to Inhibit AutophagyCardiovasc Toxicol202121975977110.1007/s12012-021-09667-w15. Zhang S, Yin Z, Dai FF, Wang H, Zhou MJ, Yang MH, et al. miR-29a Attenuates Cardiac Hypertrophy Through Inhibition of PPARδ Expression. J Cell Physiol. 2019;234(8):13252-62. doi: 10.1002/jcp.27997.ZhangSYinZDaiFFWangHZhouMJYangMHet almiR-29a Attenuates Cardiac Hypertrophy Through Inhibition of PPARδ ExpressionJ Cell Physiol20192348132521326210.1002/jcp.2799716. Li L, Wang L, Li H, Han X, Chen S, Yang B, et al. Characterization of LncRNA Expression Profile and Identification of Novel LncRNA Biomarkers to Diagnose Coronary Artery Disease. Atherosclerosis. 2018;275:359-67. doi: 10.1016/j.atherosclerosis.2018.06.866.LiLWangLLiHHanXChenSYangBet alCharacterization of LncRNA Expression Profile and Identification of Novel LncRNA Biomarkers to Diagnose Coronary Artery DiseaseAtherosclerosis201827535936710.1016/j.atherosclerosis.2018.06.86617. Liu Z, Dai J, Shen H. Dataset for Regulation between lncRNAs and their Nearby Protein-Coding Genes in Human Cancers. Data Brief. 2018;19:1902-6. doi: 10.1016/j.dib.2018.06.048.LiuZDaiJShenHDataset for Regulation between lncRNAs and their Nearby Protein-Coding Genes in Human CancersData Brief2018191902190610.1016/j.dib.2018.06.04818. Tay Y, Rinn J, Pandolfi PP. The Multilayered Complexity of ceRNA Crosstalk and Competition. Nature. 2014;505(7483):344-52. doi: 10.1038/nature12986.TayYRinnJPandolfiPPThe Multilayered Complexity of ceRNA Crosstalk and CompetitionNature2014505748334435210.1038/nature1298619. Veselka J, Anavekar NS, Charron P. Hypertrophic Obstructive Cardiomyopathy. Lancet. 2017;389(10075):1253-67. doi: 10.1016/S0140-6736(16)31321-6.VeselkaJAnavekarNSCharronPHypertrophic Obstructive CardiomyopathyLancet2017389100751253126710.1016/S0140-6736(16)31321-620. Wen ZQ, Li SH, Shui X, Tang LL, Zheng JR, Chen L. LncRNA PEG10 Aggravates Cardiac Hypertrophy Through Regulating HOXA9. Eur Rev Med Pharmacol Sci. 2019;23(3 Suppl):281-6. doi: 10.26355/eurrev_201908_18658.WenZQLiSHShuiXTangLLZhengJRChenLLncRNA PEG10 Aggravates Cardiac Hypertrophy Through Regulating HOXA9Eur Rev Med Pharmacol Sci2019233Suppl28128610.26355/eurrev_201908_18658.21. Shao M, Chen G, Lv F, Liu Y, Tian H, Tao R, et al. LncRNA TINCR Attenuates Cardiac Hypertrophy by Epigenetically Silencing CaMKII. Oncotarget. 2017;8(29):47565-73. doi: 10.18632/oncotarget.17735.ShaoMChenGLvFLiuYTianHTaoRet alLncRNA TINCR Attenuates Cardiac Hypertrophy by Epigenetically Silencing CaMKIIOncotarget2017829475654757310.18632/oncotarget.1773522. Zou X, Wang J, Tang L, Wen Q. LncRNA TUG1 Contributes To Cardiac Hypertrophy via Regulating miR-29b-3p. In Vitro Cell Dev Biol Anim. 2019;55(7):482-90. doi: 10.1007/s11626-019-00368-x.ZouXWangJTangLWenQLncRNA TUG1 Contributes To Cardiac Hypertrophy via Regulating miR-29b-3pIn Vitro Cell Dev Biol Anim201955748249010.1007/s11626-019-00368-x23. Wang DP, Tang XZ, Liang QK, Zeng XJ, Yang JB, Xu J. Overexpression of Long Noncoding RNA SLC26A4-AS1 Inhibits the Epithelial-Mesenchymal Transition via the MAPK Pathway in Papillary Thyroid Carcinoma. J Cell Physiol. 2020;235(3):2403-13. doi: 10.1002/jcp.29145.WangDPTangXZLiangQKZengXJYangJBXuJOverexpression of Long Noncoding RNA SLC26A4-AS1 Inhibits the Epithelial-Mesenchymal Transition via the MAPK Pathway in Papillary Thyroid CarcinomaJ Cell Physiol202023532403241310.1002/jcp.2914524. Li H, Yan R, Chen W, Ding X, Liu J, Chen G, et al. Long Non Coding RNA SLC26A4-AS1 Exerts Antiangiogenic Effects in Human Glioma by Upregulating NPTX1 via NFKB1 Transcriptional Factor. FEBS J. 2021;288(1):212-8. doi: 10.1111/febs.15325.LiHYanRChenWDingXLiuJChenGet alLong Non Coding RNA SLC26A4-AS1 Exerts Antiangiogenic Effects in Human Glioma by Upregulating NPTX1 via NFKB1 Transcriptional FactorFEBS J2021288121221810.1111/febs.1532525. Tang L, Yu X, Zheng Y, Zhou N. Inhibiting SLC26A4 Reverses Cardiac Hypertrophy in H9C2 Cells and in Rats. PeerJ. 2020;8:e8253. doi: 10.7717/peerj.8253.TangLYuXZhengYZhouNInhibiting SLC26A4 Reverses Cardiac Hypertrophy in H9C2 Cells and in RatsPeerJ20208e825310.7717/peerj.825326. Zhou G, Li C, Feng J, Zhang J, Fang Y. lncRNA UCA1 Is a Novel Regulator in Cardiomyocyte Hypertrophy through Targeting the miR-184/HOXA9 Axis. Cardiorenal Med. 2018;8(2):130-9. doi: 10.1159/000487204.ZhouGLiCFengJZhangJFangYlncRNA UCA1 Is a Novel Regulator in Cardiomyocyte Hypertrophy through Targeting the miR-184/HOXA9 AxisCardiorenal Med20188213013910.1159/00048720427. Wo Y, Guo J, Li P, Yang H, Wo J. Long Non-Coding RNA CHRF Facilitates Cardiac Hypertrophy Through Regulating Akt3 via miR-93. Cardiovasc Pathol. 2018;35:29-36. doi: 10.1016/j.carpath.2018.04.003.WoYGuoJLiPYangHWoJLong Non-Coding RNA CHRF Facilitates Cardiac Hypertrophy Through Regulating Akt3 via miR-93Cardiovasc Pathol201835293610.1016/j.carpath.2018.04.00328. Huang ZP, Chen J, Seok HY, Zhang Z, Kataoka M, Hu X, et al. MicroRNA-22 Regulates Cardiac Hypertrophy and Remodeling in Response to Stress. Circ Res. 2013;112(9):1234-43. doi: 10.1161/CIRCRESAHA.112.300682.HuangZPChenJSeokHYZhangZKataokaMHuXet alMicroRNA-22 Regulates Cardiac Hypertrophy and Remodeling in Response to StressCirc Res201311291234124310.1161/CIRCRESAHA.112.30068229. Cai K, Chen H. MiR-625-5p Inhibits Cardiac Hypertrophy Through Targeting STAT3 and CaMKII. Hum Gene Ther Clin Dev. 2019;30(4):182-91. doi: 10.1089/humc.2019.087.CaiKChenHMiR-625-5p Inhibits Cardiac Hypertrophy Through Targeting STAT3 and CaMKIIHum Gene Ther Clin Dev201930418219110.1089/humc.2019.08730. Hu J, Ruan J, Liu X, Xiao C, Xiong J. MicroRNA-301a-3p Suppressed the Progression of Hepatocellular Carcinoma via Targeting VGLL4. Pathol Res Pract. 2018;214(12):2039-45. doi: 10.1016/j.prp.2018.09.008.HuJRuanJLiuXXiaoCXiongJMicroRNA-301a-3p Suppressed the Progression of Hepatocellular Carcinoma via Targeting VGLL4Pathol Res Pract2018214122039204510.1016/j.prp.2018.09.00831. Wang L, Lin C, Sun N, Wang Q, Ding X, Sun Y. Long Non-Coding RNA CASC19 Facilitates Non-Small Cell Lung Cancer Cell Proliferation and Metastasis by Targeting the miR-301b-3p/LDLR Axis. J Gene Med. 2020;22(12):e3254. doi: 10.1002/jgm.3254.WangLLinCSunNWangQDingXSunYLong Non-Coding RNA CASC19 Facilitates Non-Small Cell Lung Cancer Cell Proliferation and Metastasis by Targeting the miR-301b-3p/LDLR AxisJ Gene Med20202212e325410.1002/jgm.325432. Xia X, Zhang K, Cen G, Jiang T, Cao J, Huang K, et al. MicroRNA-301a-3p Promotes Pancreatic Cancer Progression via Negative Regulation of SMAD4. Oncotarget. 2015;6(25):21046-63. doi: 10.18632/oncotarget.4124.XiaXZhangKCenGJiangTCaoJHuangKet alMicroRNA-301a-3p Promotes Pancreatic Cancer Progression via Negative Regulation of SMAD4Oncotarget2015625210462106310.18632/oncotarget.4124
Vinculação acadêmica
Não há vinculação deste estudo a programas de pós-graduação.
Aprovação ética e consentimento informado
Este artigo não contém estudos com humanos ou animais realizados por nenhum dos autores.
Fontes de financiamento: O presente estudo foi financiado por Second People’s Hospital of Hefei (No.jygh201926).
*Material suplementar
Para informação adicional, por favor, clique aqui.
Original ArticleSLC26A4-AS1 Aggravates AngII-induced Cardiac Hypertrophy by Enhancing SLC26A4 ExpressionHanXiaoliangThe authors contributed equally to this workConception and design of the research10000-0002-7366-2246LiChaoThe authors contributed equally to this workConception and design of the researchObtaining financing and Writing of the manuscript2JiQinjiongAcquisition of data and Analysis and interpretation of the data1ZhangLingAcquisition of data and Analysis and interpretation of the data1XieXiaofeiAcquisition of data and Analysis and interpretation of the data1ShangHuijuanStatistical analysis and Critical revision of the manuscript for important intellectual content1YeHongStatistical analysis and Critical revision of the manuscript for important intellectual content1ChinaDepartamento de Cardiologia, Anhui Provincial Chest Hospital, (Instituto de Controle de Tuberculose de Anhui), Hefei, Anhui – ChinaChinaDepartamento de Cardiologia, the Second People’s Hospital of Hefei (Hospital Hefei afiliado à Medical University of Anhui), Hefei, Anhui – China Mailing Address: Chao Li • The Second People’s Hospital of Hefei (Hefei Hospital Affiliated to Medical University of Anhui), Hefei, 230011, Anhui – China E-mail: vnqi46@163.com
Potential conflict of interest
No potential conflict of interest relevant to this article was reported.
AbstractBackground
It has been reported that solute carrier family 26 members 4 antisense RNA 1 (SLC26A4-AS1) is highly related to cardiac hypertrophy.
Objective
This research aims to investigate the role and specific mechanism of SLC26A4-AS1 in cardiac hypertrophy, providing a novel marker for cardiac hypertrophy treatment.
Methods
Angiotensin II (AngII) was infused into neonatal mouse ventricular cardiomyocytes (NMVCs) to induce cardiac hypertrophy. Gene expression was detected by quantitative real-time PCR (RT-qPCR). Protein levels were evaluated via western blot. Functional assays analyzed the role of SLC26A4-AS1. The mechanism of SLC26A4-AS1 was assessed by RNA-binding protein immunoprecipitation (RIP), RNA pull-down, and luciferase reporter assays. The P value <0.05 was identified as statistical significance. Student’s t-test evaluated the two-group comparison. The difference between different groups was analyzed by one-way analysis of variance (ANOVA).
Results
SLC26A4-AS1 is upregulated in AngII-treated NMVCs and promotes AngII-induced cardiac hypertrophy. SLC26A4-AS1 regulates its nearby gene solute carrier family 26 members 4 (SLC26A4) via functioning as a competing endogenous RNA (ceRNA) to modulate the microRNA (miR)-301a-3p and miR-301b-3p in NMVCs. SLC26A4-AS1 promotes AngII-induced cardiac hypertrophy via upregulating SLC26A4 or sponging miR-301a-3p/miR-301b-3p.
Conclusion
SLC26A4-AS1 aggravates AngII-induced cardiac hypertrophy via sponging miR-301a-3p or miR-301b-3p to enhance SLC26A4 expression.
CardiomegalyRNARNA, Long NoncodingIntroduction
Cardiac hypertrophy is an adaptive response for enhanced heart afterload to sustain systolic cardiac function at early stages.1 Despite that, continuous myocardial hypertrophy is a typical heart disease induced by increased heart workload accompanied by maladaptive cardiac remodeling, leading to aortic stenosis and dilated cardiomyopathy.2,3 Oversize thick ventricular walls and cardiomyocytes are the primary patterns of cardiac hypertrophy.2,3 In recent years, cardiac hypertrophy has become an urgent problem that may lead to a rising incidence of heart failure and sudden death.3
The outstanding characteristics of pathologic cardiac hypertrophy are the elevation of fetal genes such as brain natriuretic peptide (BNP), atrial natriuretic peptide (ANP), and beta-myosin heavy chain (β-MHC).4 Recent studies have proved that many factors, including specific growth factors, peptide hormones, and microRNAs (miRNAs), are accountable for cardiac hypertrophy,5 but the exact molecular mechanism underlying the progression of cardiac hypertrophy remains unclear.
Long non-coding RNAs (lncRNAs) participate in pathological processes via governing gene expression at epigenetic, transcriptional, and post-transcriptional levels.6 Growing evidence has unveiled the vital roles of lncRNAs in cardiovascular disease development, including cardiac hypertrophy.7 For instance, SP1-induced lncRNA SNHG14 promotes cardiac hypertrophy via miR-322-5p/miR-384-5p/PCDH17 network in Angiotensin II (AngII)-induced cardiomyocytes.8 LncRNA MIAT silencing restrains AngII-induced cardiac hypertrophy via miR-93/TLR4 competing endogenous RNA (ceRNA) axis.9 LncRNA solute carrier family 26 member 4 antisense RNA 1 (SLC26A4-AS1) has been reported as highly associated with cardiac hypertrophy.10 Nonetheless, the effect and regulatory mechanism of SLC26A4-AS1 in cardiac hypertrophy remain vague.
MiRNAs are another type of non-coding RNA with a length of about 22 nucleotides.11 MiRNAs usually exert cellular functions via targeting downstream messenger RNAs (mRNAs).12 Numerous miRNAs have been pointed out as essential regulators in the progression of cardiac hypertrophy.13 For example, miR-17-5p facilitates AngII-induced cardiac hypertrophy via inhibiting Mfn2 expression and activating the PI3K/AKT/mTOR axis to suppress autophagy.14 MiR-29a relieves isoproterenol hydrochloride-induced cardiac hypertrophy by repressing PPARδ expression.15 Considering the vital role of miRNAs in cardiac hypertrophy, we tried to investigate the regulatory mechanism of SLC26A4-AS1 by focusing on the miRNAs that interact with it.
In the current study, the effect of SLC26A4-AS1 on the level of BNP, ANP, and β-MHC was explored to determine the function of SLC26A4-AS1 in AngII-induced cardiac hypertrophy. The regulatory mechanism of SLC26A4-AS1 was investigated via the ceRNA axis. Our study might offer a novel insight into the fundamental mechanisms of lncRNA in cardiac hypertrophy, providing a novel target for cardiac hypertrophy treatment.
MethodsCell culture and treatment
Cardiomyocytes were isolated from the neonatal mice. The ethics committee of our Hospital approved animal experiments. To induce hypertrophy of cardiomyocytes, the extracted hearts were split into pieces and treated with 0.25% trypsin (1/400, Beyotime, Shanghai, China), followed by incubation in Dulbecco’s modified Eagle medium/F-12 (500mL, Thermo Fisher Scientific, Rockford, IL, USA) with 10% FBS (1/10, Invitrogen, Carlsbad, CA, USA). After cell confluence reached 80%, cells in the dishes were transferred to culture plates and inoculated with AngII (150 nM, Sigma-Aldrich, St. Louis, MO, USA) with the concentration of 150 nM for 1, 6, 12, and 24 h to stimulate hypertrophic phenotypes of cardiomyocytes, establishing the cell model of cardiac hypertrophy.
Cell transfection
Short hairpin RNAs (shRNAs) against SLC26A4-AS1 (sh-SLC26A4-AS1#1/2, 3ul/ug, GenePharma Co., Ltd., Shanghai, China), shRNAs against solute carrier family 26 member 4 (SLC26A4) (sh-SLC26A4#1/2, 3ul/ug, GenePharma Co., Ltd.), negative control of shRNA (sh-NC, 3ul/ug, GenePharma Co., Ltd.), pcDNA3.1-SLC26A4 (3ul/ug, GenePharma Co., Ltd.), pcDNA3.1 empty vector (pcDNA3.1, 3ul/ug, GenePharma Co., Ltd.), microRNA (miR)-301a-3p mimics (3ul/ug, GenePharma Co., Ltd.), miR-301b-3p mimics (3ul/ug, GenePharma Co., Ltd.), (NC mimics, 3ul/ug, GenePharma Co., Ltd.), miR-301a-3p inhibitor (3ul/ug, GenePharma Co., Ltd.), miR-301b-3p inhibitor (3ul/ug, GenePharma Co., Ltd.) and negative control of miRNA inhibitor (NC inhibitor, 3ul/ug, GenePharma Co., Ltd.) were all purchased from GenePharma Co., Ltd. (Shanghai, China). All cell transfections were applied using Lipofectamine 3000 (1.5ug/ml, Invitrogen), followed by the treatment of 150 nM AngII for 24 h.
Quantitative real-time PCR (RT-qPCR)
Total RNA from cells was extracted by TRIzol (1mL, Invitrogen) reagent. The total RNA concentration was determined by measuring the absorption value at 260nm with a microspectrophotometer. The RNA (1μl) was reversely transcribed to compose complementary DNA using M-MLV reverse transcriptase (10000u, Promega, Madison, WI, USA). Afterward, qPCR was conducted with the SYBR Premix Ex Taq™ II kit (Takara, Japan). The expression of miRNA was normalized to U6, and that of lncRNA and mRNA was normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH), which was based on the 2Ctmethod. RT-qPCR analysis was performed as described previously.16 Three independent assays were conducted. The primer sequence for SLC26A4-AS1 and GAPDH is shown in Table 1.
– Primer sequence for SLC26A4-AS1 and GAPDH
Genes
Sequence
SLC26A4-AS1
F:TGCTGTTGCTGGAAAGCGAG R: TATTCCTTCCCGCGTGTCCT
GAPDH
F: GACAGTCAGCCGCATCTTCT R:GCGCCCAATACGACCAAATC
F: forward primer; R: reverse primer.
Western blot
RIPA lysis buffer (100mL, Thermo Fisher Scientific) was used to extract total proteins, and protein concentration was verified using a BCA protein assay kit (Abcam, USA). After the treatment of sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE, 1/10, Invitrogen), proteins were transferred onto PVDF membrane (Millipore, USA) and blocked in 5% defatted milk. Subsequently, the membrane was cultured with primary antibodies against ANP (1µg/ml, ab237632, Abcam, Cambridge, MA, USA), BNP (1µg/ml, ab92500, Abcam), β-MHC (1/2500, ab55152, Abcam), SLC26A4 (0.25 µg/μl, 20889-1-AP, Proteintech, Chicago, USA) and GAPDH (1/2500, ab8245, Abcam) at 4°C overnight. After being washed, the membrane was cultured with HRP-conjugated secondary antibody (1/2500, Abcam) for 1 h. The signal was measured using the enhanced chemiluminescence western blotting substrate. All independent experiments were repeated three times.
Immunofluorescence (IF) staining and cell surface area assay
Cells were washed and fixed and were blocked with normal goat serum containing 1% BSA (1/100, Sigma-Aldrich). Subsequently, cells were cultured with anti-α-actinin (1/100, Sigma-Aldrich) at 4°C for a whole night and were further hatched with a secondary antibody for 1 h. DAPI (4’,6-diamidino-2-phenylindole, 1/2000, Abcam) was applied to stain the nuclei, and a fluorescence microscope was used to capture the images and assess the cell surface area. Three independent assays were conducted.
Subcellular fractionation
A PARIS kit (Thermo Scientific, USA) was applied for isolating the cytoplasmic and nuclear fractions from neonatal mouse ventricular cardiomyocytes (NMVCs). GAPDH, U6, or SLC26A4-AS1 expression in the nucleus and cytoplasm was assessed by RT-qPCR analysis. Three independent assays were conducted.
Fluorescent in situ hybridization (FISH)
Alexa Fluor 555-labeled SLC26A4-AS1 probes (50ng, RiboBio, Guangzhou, China) were synthesized by RiboBio (Guangzhou, China). FISH experiments were implemented with a FISH kit (RiboBio). Cells were seeded into slides for 24 h of incubation. After fixation and permeabilization, cells were cultured with SLC26A4-AS1 probes at 37°C overnight. DAPI was utilized to stain cell nuclei, and the images were observed under a fluorescence microscope. Bio-repeats were conducted in triplicate.
RNA binding protein immunoprecipitation (RIP)
Based on the instructions, the Magna RIP RNA-binding protein immunoprecipitation kit (Millipore) and the Ago2 antibody (1/30, Abcam) were used to perform RIP assays. Co-precipitated RNAs were analyzed via RT-qPCR. Three independent assays were conducted.
RNA pull-down assay
NMVCs were transfected with a biotinylated SLC26A4-AS1 probe for 48 h. Then collected cells were cultured with M-280 streptavidin magnetic beads (10 mg/ml, Invitrogen). The bound RNAs were assessed via RT-qPCR. Three independent assays were conducted.
Luciferase reporter assay
The sequence of SLC26A4-AS1 or SLC26A4 3’UTR containing the predicted binding site with miR-301a-3p and miR-301b-3p were severally cloned into the pmirGLO dual luciferase vector (1 µg, Promega), as well as the putative and mutated sequences. Cells (3 × 104/well) were grown in 24-well plates for incubation. Cells were then transfected with these reporter plasmids and miR-301a-3p mimics or miR-301b-3p mimics, respectively. After 48 h transfection using Lipofectamine 3000 reagent, a Dual-Luciferase Reporter Assay kit (Promega) was applied to measure the relative luciferase activity. Three independent assays were conducted.
Statistical analysis
All experiments were in triplicate, and all independent experiments were repeated three times. The sample size in this study was defined using the random sampling method and calculated using the formula n=2σ2/δ2 f(α, β), where δ is the minimum difference, σ is the total standard deviation, α is inspection level (=0.05), and β is the rate of type II mistake (=0.10). Data were shown as the mean ± standard deviation for 3 independent assays. GraphPad Prism Version 5.0 Software was applied to analyze data. Data normality was checked using the Shapiro-Wilk test, which showed that all data followed the normal distribution. The statistical significance among groups was investigated by the unpaired Student’s t-test or one-way analysis of variance, followed by a post hoc test (Tukey and Dunnett). Besides, a p value less than 0.05 was identified as statistically significant.
ResultsSLC26A4-AS1 is upregulated in cardiomyocyte hypertrophy induced by AngII
To evaluate the specific role of SLC26A4-AS1 in cardiac hypertrophy, we first treated NMVCs with AngII to induce hypertrophic phenotypes of cardiomyocytes. The levels of hypertrophic biomarkers (ANP, BNP, and β-MHC) in AngII-treated NMVCs were gradually increased over time (Figure 1A-1C). Staining showed that the surface area of AngII-treated NMVCs was gradually increased over time (Figure 1D). Besides, significant up-regulation of SLC26A4-AS1 in NMVCs was also observed as time-dependent after AngII treatment (Figure 1E). In a word, SLC26A4-AS1 is upregulated in AngII-induced hypertrophy of cardiomyocytes.
– SLC26A4-AS1 is upregulated in AngII-induced cardiac hypertrophy. (A-C) In NMVCs treated with 150 nM AngII for 1, 6, 12, and 24 h, the expression of hypertrophic biomarkers (ANP, BNP, and β-MHC) was assessed using RT-qPCR, and the protein level of these biomarkers was evaluated through western blot, followed by western blot quantification. *P<0.05: AngII (1 h) vs AngII (0 h). *P<0.05: AngII (6 h) vs AngII (0 h). **P<0.01: AngII (12 h) vs AngII (0 h). **P<0.01: AngII (24 h) vs AngII (0 h). The number of sample size (n) = 3. (D) The cell surface area in NMVCs treated with 150 nM AngII for 1, 6, 12, and 24 h was assessed using IF staining. Scale bar: 10 μm. *P<0.05: AngII (1 h) vs AngII (0 h). *P<0.05: AngII (6 h) vs AngII (0 h). **P<0.01: AngII (12 h) vs AngII (0 h). **P<0.01: AngII (24 h) vs AngII (0 h). n = 3. (E) SLC26A4-AS1 expression in NMVCs treated with 150 nM AngII for 1, 6, 12, and 24 h was detected using RT-qPCR. *P<0.05: AngII (1 h) vs AngII (0 h). *P<0.05: AngII (6 h) vs AngII (0 h). **P<0.01: AngII (12 h) vs AngII (0 h). **P<0.01: AngII (24 h) vs AngII (0 h). n = 3.
SLC26A4-AS1 facilitates cardiac hypertrophy which was induced by AngII
Furthermore, RT-qPCR analysis verified the successful transfection of sh-SLC26A4-AS1#1/2 plasmids in AngII-induced NMVCs (Figure 2A). The increased cell surface area in NMVCs caused by AngII was attenuated by SLC26A4-AS1 silencing (Figure 2B). Meanwhile, the upregulated expression and protein level of ANP, BNP, and β-MHC induced by AngII were reversed after SLC26A4-AS1 knockdown (Figure 2C-2H). These results uncovered that SLC26A4-AS1 promotes AngII-induced cardiac hypertrophy in vitro.
– SLC26A4-AS1 silence suppresses AngII-induced cardiac hypertrophy. (A) NMVCs were treated with sh-SLC26A4-AS1#1/2 or sh-NC after the treatment of AngII for 24 h. **P<0.01: AngII vs Control. **P<0.01: AngII+sh-SLC26A4-AS1#1/2 vs AngII+sh-NC. n = 3. (B) Cell surface area was detected in AngII-treated NMVCs upon SLC26A4-AS1 silence using IF staining. Scale bar: 10 μm. **P<0.01: AngII vs Control. **P<0.01: AngII+sh-SLC26A4-AS1#1/2 vs AngII+sh-NC. n = 3. (C-H) After SLC26A4-AS1 silencing, the expression of hypertrophic biomarkers in AngII-treated NMVCs was measured using RT-qPCR, and the level of these biomarkers was assessed using western blot, followed by the quantification of western blot. **P<0.01: AngII vs Control. **P<0.01: AngII+sh-SLC26A4-AS1#1/2 vs AngII+sh-NC. n = 3.
SLC26A4-AS1 interacts with SLC26A4, and SLC26A4 promotes cardiac hypertrophy induced by AngII
Subcellular fractionation and FISH assays were first implemented to study the potential mechanism of SLC26A4-AS1 in AngII-induced cardiac hypertrophy. We uncovered that SLC26A4-AS1 was preferentially located in the cell cytoplasm, suggesting the post-transcriptional role of SLC26A4-AS1 in AngII-treated NMVCs (Figure 3A-3B). It has been reported that lncRNAs can regulate their nearby genes to exert functions in developing diseases.17 As shown in Figure Supplementary S3A, the UCSC database (http://genome.ucsc.edu/) predicted that SLC26A4 was a nearby gene of SLC26A4-AS1. Therefore, we conjectured that SLC26A4-AS1 might regulate SLC26A4 to affect AngII-induced cardiac hypertrophy. Then, Ago2-RIP assays were performed for that Ago2 is the central component of RNA-induced silencing complex 22. SLC26A4-AS1 and SLC26A4 were highly abundant in anti-Ago2 bound precipitates (Figure 3C). RT-qPCR displayed that SLC26A4 expression was significantly elevated over time with the treatment of AngII (Figure 3D). Besides, the increased expression and protein level of SLC26A4 caused by AngII treatment were diminished when SLC26A4-AS1 was silenced (Figure 3E-3F). In a word, SLC26A4-AS1 interacts with SLC26A4 in NMVCs.
– SLC26A4-AS1 functions as a ceRNA to regulate SLC26A4 in cardiac hypertrophy induced by AngII. (A-B) Subcellular fractionation and FISH assays were performed to determine the location of SLC26A4-AS1 in AngII-induced NMVCs. n = 3. (C) RIP assays detected the enrichment of SLC26A4-AS1 and SLC26A4. **P<0.01: Ago2 vs IgG. n = 3. (D) The expression of SLC26A4 in NMVCs treated with 150 nM AngII for 1, 6, 12, and 24 h was assessed using RT-qPCR. *P<0.05: AngII (1 h) vs AngII (0 h). *P<0.05: AngII (6 h) vs AngII (0 h). **P<0.01: AngII (12 h) vs AngII (0 h). **P<0.01: AngII (24 h) vs AngII (0 h). n = 3. (E-F) Expression level and protein level of SLC26A4 in AngII-treated NMVCs were assessed using RT-qPCR and western blot, respectively, after SLC26A4-AS1 down-regulation, followed by the quantification of western blot. **P<0.01: AngII vs Control. **P<0.01: AngII+sh-SLC26A4-AS1#1/2 vs AngII+sh-NC. n = 3.
To detect the function of SLC26A4 in AngII-induced cardiac hypertrophy, loss-of-function assays were performed after the efficiency of sh-SLC26A4#1/2 in AngII-treated NMVCs was verified (Figure Supplementary S1A). SLC26A4 downregulation reversed the increased surface area of AngII-treated NMVCs (Figure Supplementary S1B) and the upregulation of hypertrophic biomarker levels stimulated by AngII treatment (Figure Supplementary S1C-S1H). Collectively, SLC26A4 promotes AngII-induced cardiac hypertrophy in vitro.
SLC26A4-AS1 promotes AngII-induced cardiac hypertrophy via upregulating SLC26A4
Then, the efficiency of pcDNA3.1-SLC26A4 was certified in AngII-treated NMVCs (Figure 4A). As shown in Figure 4B-4E, cell surface area and the levels of hypertrophic biomarkers in AngII-treated NMVCs were obviously reduced with SLC26A4-AS1 downregulation. However, this inhibition effect was reversed after co-transfection of pcDNA3.1-SLC26A4. Taken together, SLC26A4-AS1 promotes AngII-induced cardiac hypertrophy through upregulating SLC26A4.
– SLC26A4-AS1 promove hipertrofia cardíaca induzida por AngII via regulação para cima de SLC26A4. (A) NMVCs introduzidos com pcDNA3.1-SLC26A4, ou pcDNA3.1 foram tratados com AngII por 24 h. **P<0,01: pcDNA3.1-SLC26A4 vs pcDNA3.1. Experimentos de resgate foram conduzidos em NMVCs com a transfecção de sh-NC, sh-SLC26A4-AS1#1, sh-SLC26A4-AS1#1+pcDNA3.1 e sh-SLC26A4-AS1#1+pcDNA3.1-SLC26A4 sob tratamento com AngII . n = 3. (B) A área da superfície celular foi avaliada em NMVCs tratados com AngII usando coloração IF. **P<0,01: AngII vs Controle. **P<0,01: AngII+sh-SLC26A4-AS1#1 vs AngII+sh-NC. **P<0,01: AngII+sh-SLC26A4-AS1#1+pcDNA3.1-SLC26A4 vs AngII+sh-SLC26A4-AS1#1+pcDNA3.1. n = 3. (C-E) O nível de expressão e o nível de proteína de biomarcadores hipertróficos em NMVCs tratados com AngII foram medidos por meio de RT-qPCR e western blot, respectivamente, seguidos pela quantificação de western blot. **P<0,01: AngII vs Controle. **P<0,01: AngII+sh-SLC26A4-AS1#1 vs AngII+sh-NC. **P<0,01: AngII+sh-SLC26A4-AS1#1+pcDNA3.1-SLC26A4 vs AngII+sh-SLC26A4-AS1#1+pcDNA3.1. n = 3.
SLC26A4-AS1 positively regulates SLC26A4 via functioning as sponges of miR-301a-3p or miR-301b-3p
It is well-acknowledged that lncRNAs can function as competing for endogenous RNAs (ceRNAs) to regulate gene expression via interacting with miRNAs at post-transcriptional levels.18 Six miRNAs were sifted out to determine the target miRNAs combined with SLC26A4-AS1 and SLC26A4 (Figure 5A). MiR-301a-3p and miR-301b-3p were notably abundant in the bio-SLC26A4-AS1 group relative to the bio-NC group (Figure 5B). Furthermore, SLC26A4-AS1, miR-301a-3p, miR-301b-3p, and SLC26A4 were all markedly enriched in the Ago2 group (Figure 5C), indicating the presence of ceRNA network among these four RNAs. RT-qPCR revealed that both miR-301a-3p and miR-301b-3p were lowly expressed in AngII-treated NMVCs in a time-dependent manner (Figure 5D-5E). After the efficiency of the overexpression of miR-301a-3p or miR-301b-3p was verified Figure Supplementary S2A-S2B), we found that the cell surface area and hypertrophic biomarker levels in AngII-induced NMVCs were markedly decreased by miR-301a-3p or miR-301b-3p overexpression (Figure Supplementary S2C-S2F). All these data suggested that miR-301a-3p or miR-301b-3p could suppress AngII-induced cardiac hypertrophy in vitro.
– SLC26A4-AS1 positively regulates SLC26A4 expression via sponging miR-301a-3p or miR-301b-3p. (A) Candidate miRNAs combined with SLC26A4-AS1 and SLC26A4 were obtained from the starBase website (http://starbase.sysu.edu.cn). (B) The relative enrichment of candidate miRNAs in bio-SLC26A4-AS1 groups was analyzed via RNApull-down assay. **P<0.01: Bio-SLC26A4-AS1 vs Bio-NC. n = 3. (C) The RIP assay detected the relative enrichment of SLC26A4-AS1, miR-301a-3p, miR-301b-3p, and SLC26A4. **P<0.01: Ago2 vs IgG. n = 3. (D-E) Expression of miR-301a-3p or miR-301b-3p in NMVCs treated with 150 nM AngII for 1, 6, 12, and 24 h was detected using RT-qPCR. *P<0.05: AngII (1h)/AngII (6h) vs AngII (0 h). **P<0.01: AngII (12h)/AngII (24h) vs AngII (0 h). n = 3. (F) Luciferase reporter assays were implemented to detect the luciferase activity of SLC26A4-AS1 wild-type (WT) or mutant-type (MUT). **P<0.01: miR-301a-3p mimics/miR-301b-3p mimics vs NC mimics. n = 3. (G) Luciferase reporter assays were performed to detect the luciferase activity of SLC26A4 3’UTR WT or MUT. **P<0.01: miR-301a-3p mimics/miR-301b-3p mimics vs NC mimics. n = 3. (H) The effects of miR-301a-3p or miR-301b-3p overexpression on SLC26A4 expression were assessed via RT-qPCR. **P<0.01: AngII vs Control. **P<0.01: AngII+miR-301a-3p mimics/miR-301b-3p mimics vs AngII+NC mimics. n = 3.
As shown in Figure Supplementary S3B, the respective binding sites of the two miRNAs on SLC26A4-AS1 were predicted from the starBase database. Overexpressed miR-301a-3p or miR-301b-3p significantly reduced the activity of wild-type SLC26A4-AS1 rather than that of SLC26A4-AS1-MUT (Figure 5F). The binding sequences of miR-301a-3p or miR-301b-3p on SLC26A4 3’UTR were also shown in Figure Supplementary S3B. The luciferase activity of SLC26A4 3’UTR wild-type was decreased in AngII-induced NMVCs after the overexpression of miR-301a-3p or miR-301b-3p (Figure 5G). Additionally, it turned out that miR-301a-3p mimics or miR-301b-3p mimics could impair the expression of SLC26A4 in AngII-induced NMVCs (Figure 5H). To sum up, SLC26A4-AS1 positively regulates SLC26A4 expression via serving as a ceRNA to sponge miR-301a-3p/miR-301b-3p.
SLC26A4-AS1 affects AngII-induced cardiac hypertrophy via sponging miR-301a-3p or miR-301b-3p
To explore whether SLC26A4-AS1 affects AngII-induced cardiac hypertrophy via regulating miR-301a-3p/miR-301b-3p, we firstly inhibited the expression of miR-301a-3p and miR-301b-3p in AngII-induced NMVCs (Figure 6A-6B). The declined cell surface area caused by SLC26A4-AS1 silence was reversed after the co-transfection of miR-301a-3p inhibitor or miR-301b-3p inhibitor (Figure 6C). Likewise, the inhibited expression and protein level of hypertrophic biomarkers induced by SLC26A4-AS1 knockdown were counteracted when miR-301a-3p or miR-301b-3p were silenced together (Figure 6D-6F). Taken together, SLC26A4-AS1 affects AngII-induced cardiac hypertrophy via sponging miR-301a-3p or miR-301b-3p in vitro.
– SLC26A4-AS1 affects AngII-induced cardiac hypertrophy via sponging miR-301a-3p or miR-301b-3p. (A-B) NMVCs introduced with miR-301a-3p inhibitor/miR-301b-3p inhibitor, or NC inhibitor were treated with AngII for 24 h. **P<0.01: miR-301a-3p inhibitor/miR-301b-3p inhibitor vs NC inhibitor. Rescue experiments were conducted in NMVCs with the transfection of sh-NC, sh-SLC26A4-AS1#1, sh-SLC26A4-AS1#1+NC inhibitor, sh-SLC26A4-AS1#1+miR-301a-3p inhibitor, and sh-SLC26A4-AS1#1+miR-301b-3p inhibitor under AngII treatment. n = 3. (C) Cell surface area was measured in AngII-treated NMVCs using IF staining. Scale bar: 10 μm. **P<0.01: AngII vs Control. **P<0.01: AngII+sh-SLC26A4-AS1#1 vs AngII+sh-NC. *P<0.05: AngII+sh-SLC26A4-AS1#1+miR-301a-3p inhibitor/miR-301b-3p inhibitor vs AngII+sh-SLC26A4-AS1#1+NC inhibitor. n = 3. (D-F) RT-qPCR and western blot evaluated the expression level and protein level of hypertrophic biomarkers in AngII-treated NMVCs, respectively, followed by the quantification of western blot. **P<0.01: AngII vs Control. **P<0.01: AngII+sh-SLC26A4-AS1#1 vs AngII+sh-NC. *P<0.05: AngII+sh-SLC26A4-AS1#1+miR-301a-3p inhibitor/miR-301b-3p inhibitor vs AngII+sh-SLC26A4-AS1#1+NC inhibitor. n = 3.
Discussion
Cardiac hypertrophy is divided into physiological and pathological hypertrophy. Pathological cardiac hypertrophy is the main induction factor for the progression of heart failure with abnormal expressions of cardiac genes, altered cardiac morphology, and maladaptive cardiac remodeling.19 In recent years, many researchers have revealed that lncRNAs are important regulators in the progression of pathological cardiac hypertrophy. LncRNA PEG10 is upregulated in phenylephrine-treated primary cardiomyocytes and exacerbates phenylephrine-induced cardiac hypertrophy through modulating HOXA9.20 LncRNA TINCR relieves AngII-induced cardiac hypertrophy via down-regulating CaMKII.21 LncRNA TUG1 is upregulated in AngII-treated hypertrophic H9c2 cells and promotes AngII-induced cardiac hypertrophy via interacting with miR-29b-3p.22 In the present study, we found that a novel lncRNA SLC26A4-AS1 is highly associated with cardiac hypertrophy10 and upregulated in AngII-induced hypertrophic cardiomyocytes. Furthermore, SLC26A4-AS1 silencing impaired cell surface area and the level of ANP, BNP, and β-MHC in AngII-induced hypertrophic cardiomyocytes. SLC26A4-AS1 has been associated with the development of several cancers, such as papillary thyroid carcinoma23 and glioma,24 but its role and potential mechanism in cardiac hypertrophy remain largely unclear. In this research, we verified the promotion of SLC26A4-AS1 on AngII-induced cardiac hypertrophy in vitro for the first time.
Another finding of this research was that SLC26A4-AS1 regulates its nearby gene SLC26A4 to affect AngII-induced cardiac hypertrophy. SLC26A4 has been reported to increase cardiac hypertrophy.25 Consistent with this evidence, this research confirmed that silencing SLC26A4 suppresses AngII-induced cardiac hypertrophy. Moreover, SLC26A4 overexpression could offset the suppressive effect of SLC26A4-AS1 depletion on AngII-induced cardiac hypertrophy.
Recent studies have demonstrated that lncRNAs could work by ceRNA network to drive cardiac hypertrophy, in which lncRNA serves as a miRNA sponge to regulate the expression of mRNAs. Zhou et al. have proved that lncRNA UCA1 facilitates cardiac hypertrophy progression by competitively modulating miR-184 to affect HOXA9 expression.26 Li et al. have demonstrated that lncRNA MIAT accelerates AngII-induced cardiac hypertrophy through modulating miR-93 and TLR4.9 Wo et al. have uncovered that CHRF promotes isoproterenol-induced cardiac hypertrophy by targeting miR-93 and Akt3.27 The current study also demonstrated that SLC26A4-AS1 regulates SLC26A4 expression via functioning as ceRNAs to sponge miRNAs at a post-transcriptional level. After finding the common miRNAs of SLC26A4-AS1 and SLC26A4, we revealed that SLC26A4-AS1 regulates SLC26A4 via functioning as ceRNAs to sponge miR-301a-3p or miR-301b-3p.
Previous studies have uncovered that miRNAs exert vital functions in cardiac hypertrophy. MiR-22 acts as a vital modulator of cardiomyocyte hypertrophy and cardiac remodeling.28 MiR-625-5p represses cardiac hypertrophy via interacting with CaMKII and STAT3.29 MiR-29a facilitates cardiac hypertrophy via the PTEN/AKT/mTOR pathway. MiR-301a-3p and miR-301b-3p have also been reported to be implicated in human cancers, such as hepatocellular carcinoma,30 non-small cell lung cancer,31 and pancreatic cancer.32 Nonetheless, the suppressive role of miR-301a-3p and miR-301b-3p in AngII-induced cardiac hypertrophy was proved for the first time. Additionally, inhibition of miR-301a-3p or miR-301b-3p could reverse the repressive effects of SLC26A4-AS1 silencing on AngII-induced cardiac hypertrophy.
Conclusion
In conclusion, this research found that SLC26A4-AS1 regulates the miR-301a-3p/miR-301b-3p/SLC26A4 axis to facilitate cardiac hypertrophy induced by AngII, which shed light on a promising biomarker for cardiac hypertrophy treatment.
Nonetheless, the current study was performed only in vitro experiments to investigate the effect of SLC26A4-AS1 in cardiomyocytes, which poses certain limitations. To improve our understanding of the specific role and underlying mechanism of SLC26A4-AS1 in cardiac hypertrophy, we will perform in vivo experiments and clinicopathological analysis of SLC26A4-AS1 in cardiac hypertrophy in our future research.
Study association
This study was supported by the Second People’s Hospital of Hefei (No.jygh201926).
Ethics approval and consent to participate
This article does not contain any studies with human participants or animals performed by any of the authors.
Sources of funding: There were no external funding sources for this study.