Arq Bras CardiolabcArquivos Brasileiros de CardiologiaArq. Bras. Cardiol.0066-782X1678-4170Sociedade Brasileira de Cardiologia - SBCRwN75bYDrWxLGKHJp5JJcfDS0066-782X2021000200315abc.2019043710.36660/abc.20190437Artigo OriginalOs Efeitos da Doxorrubicina na Biossíntese e no Metabolismo do Heme em CardiomiócitosWangZuoyan1GaoJunyi1TengHaobo10000-0002-0068-8728PengJianjun1Capital Medical UniversityBeijing Shijitan HospitalBeijingChinaCapital Medical University Affiliated Beijing Shijitan Hospital,Beijing - China Correspondência: Jianjun Peng • Capital Medical University Affiliated Beijing Shijitan Hospital - No.10 Tieyi Road, Haidian District, Beijing, 100038, China Beijing 100038 E-mail: pengjianjun2361@bjsjth.cn
Contribuição dos autores
Concepção e desenho da pesquisa e Redação do manuscrito: Wang Z; Obtenção de dados e Análise estatística: Wang Z, Gao J, Teng H; Análise e interpretação dos dados e Revisão crítica do manuscrito quanto ao conteúdo intelectual importante: Wang Z, Peng J.
Potencial conflito de interesses
Declaro não haver conflito de interesses pertinentes.
010320210220211162315322300620191911201927122019 This is an Open Access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. ResumoFundamento
A doxorrubicina está associada à cardiotoxicidade e à morbidade cardíaca tardia. O heme está relacionado ao stress oxidativo celular. Entretanto, sua regulação específica em cardiomiócitos sob os efeitos de doxorrubicina ainda não foi documentada.
Objetivo
Nosso objetivo é avaliar as alterações de enzimas limitantes de velocidade no caminho metabólico do heme sob o efeito de doxorrubicina.
Métodos
Cardiomiócitos H9c2 com doxorrubicina em concentrações diferentes (1, 2, 5, 10μM respectivamente). Os testes de PCR em tempo real e Western Blot foram usados para determinar a expressão de proteína e mRNA para quatro enzimas cruciais (ALAS1, ALAS2, HOX-1, e HOX-2) que regulam o metabolismo do heme celular, e os níveis de heme foram detectados por ELISA. Um p<0,01 foi considerado significativo.
Resultados
Observamos um padrão com alteração dependendo da dose nos níveis de heme nas células H9c2 com o nível mais alto na concentração de 5μM de doxorrubicina, o que ocorreu sincronicamente com o nível mais alto de regulação para cima de ALAS1, bem como as enzimas degenerativas HOX-1 e HOX-2 na expressão de proteína e mRNA. Em contraste, observamos que a ALAS2 foi regulada para baixo gradualmente, inversamente proporcional às concentrações de doxorrubicina.
Conclusão
O aumento da expressão de ALAS1 pode ter um papel na elevação do nível do heme quando o cardiomiócito H9c2 for exposto à doxorrubicina, e pode ser um alvo terapêutico para a toxicidade miocárdica induzida por doxorrubicina. (Arq Bras Cardiol. 2021; 116(2):315-322)
DoxorrubicinaBiosínteseHemeMiócitos CardíacosCardiotoxicidadeALASBeijing Municipal Natural Science Foundation7162089Fontes de financiamento.O presente estudo foi financiado pela Beijing Municipal Natural Science Foundation (Grant nº 7162089).Introdução
Com a progressão contínua das drogas antitumorais e radioterapia, o índice de sobrevivência dos pacientes com tumores malignos melhorou, e seu período de sobrevivência é significativamente aumentado. Entretanto, o uso disseminado de drogas antitumorais é acompanhado de um aumento dos eventos cardiovasculares adversos, que afeta a sobrevivência e a qualidade de vida do paciente. Antraciclinas são drogas derivadas da estreptomicina, incluindo a doxorrubicina, e da epirrubicina, que são amplamente utilizadas para tratar câncer de mama, câncer do pulmão de pequenas células, mieloma, sarcoma, linfoma e leucemia. A miocardiopatia e a insuficiência cardíaca subsequente são as manifestações mais graves de cardiotoxicidade causadas por drogas antraciclinas na quimioterapia. Além disso, a toxicidade cardiovascular das antraciclinas depende da dose e é irreversível.1,2
O mecanismo exato da toxicidade miocárdica induzida por drogas antraciclinas ainda não é clara, embora várias teorias tenham sido propostas, incluindo a inibição da replicação de DNA e transcrição de RNA; o dano ao DNA causado por radicais livres, peroxidação lipídica e alquilação; a ligação cruzada do DNA; interferência no desenrolamento do DNA; a inibição da topoisomerase II, etc.
O heme é uma porfirina ligante importante, como suplemento da proteína do heme, tem a função fisiológica de transportar o O2 no corpo. Muitas funções biológicas relacionadas à vida, tais como o transporte de elétrons, o armazenamento de oxigênio, a transdução de sinal, e a expressão genética são controladas pelas várias proteínas heme. Estudos recentes detectaram que os níveis de heme aumentaram significativamente em modelos de insuficiência cardíaca isquêmica miocárdica de ratos, sugerindo que o heme possa ter um papel importante em lesões miocárdicas isquêmicas e hipóxicas.3,4 Entretanto, não há trabalhos publicados na literatura que exploram a alteração da biossíntese ou do metabolismo do heme em cardiomiócitos, sob tratamento com antraciclinas.
A biossíntese do heme é iniciada pela formação do ácido δ-aminolevulínico (ALA) a partir da glicina (Gly) e succinil coenzima A, catalisada pela sintase do ALA (ALAS), que tem duas isoenzimas: ALAS1 e ALAS2. Por outro lado, a heme oxigenase (HOX) media o primeiro passo do catabolismo do heme, e divide o heme para formar a biliverdina. Duas isoformas ativas de HOX foram identificadas, a HOX-1 induzível, e a menos regulada HOX-2.
O objetivo deste estudo foi elucidar as alterações de perfis de quatro enzimas cruciais, a sintase do ácido aminolevulínico 1 (ALAS1), a sintase do ácido aminolevulínico 2 (ALAS2), heme oxigenase 1 (HOX-1), e heme oxigenase 2 (HOX-2), no cardiomiócito H9c2 em tratamento com doxorrubicina.
MétodosCultura celular e tratamento com doxorrubicina
Foram comprados cardiomiócitos H9c2 da American Type Culture Collection (ATCC, Manassas, VA, EUA) e foi feita a cultura em meio DMEM/F12 contendo 10% de soro fetal bovino e 1% de meio de anticorpo duplo, nas condições de 37 °C e 5% de CO2, em câmara umidificada. As células de H9c2 foram distribuídas em placas de titulação de 6 poços, num índice de 2 × 105 células/poço em um volume de 2 mL e em cultura de meio DMEM/F12 contendo 10% de soro fetal bovino, por 24 h. Depois disso, doses diferentes de doxorrubicina (1,2,5,10 μM, respectivamente) foram adicionados aos poços da placa de titulação. Consideramos células não tratadas com doxorrubicina (tratadas com solução salina) como grupo de controle. Depois de 24 horas de incubação a 37ºC, as células de poços diferentes foram coletadas separadamente por centrifugação (10000 rpm por 10 minutos a 4°C) e usadas para estudos posteriores abaixo.
PCR quantitativo em tempo real
O RNA total foi extraído das células H9c2 de todos os grupos utilizando o TRIzol (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, EUA), e foi feita a transcrição reversa com o kit SuperScript Double-Strand Synthesis (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA) de acordo com as instruções do fabricante, e amplificado em um sistema de PCR de tempo real 7500 Fast com SYBR GreenER qPCR SuperMix Universal (Invitrogen; Thermo Fisher Scientific, Inc.). Os primers usados para amplificar ALAS1, ALAS2, HOX-1, e HOX-2 foram projetados usando os softwares Primer3 (v. 0.4.0). Os seguintes primers foram usados para o PCR em tempo real:
ALAS1-F:TTGCCAAAGTCCGTTTCC
R: TGTAGTCATCTGCCATAGGG 3’;
ALAS2-F: TCAAGGGAGAGGAGGGTCAAG
R: ACGAGGCACAGTTGGGTAG
HOX-1-F:TCGACAACCCCACCAAGTT
R:CTGGCGAAGAAACTCTGTCT
HOX-2-F:GCTTACACTCGTTACATGGG
R: CACATGCTCGAACAGGTAGA
GAPDH-F: GATGACATCAAGAAGGTGGTGA
R:ACCCTGTTGCTGTAGCCATATTC.
As condições de reação foram as seguintes: 95 °C por 3 min; 95 °C por 30 seg, 55 °C por 20 seg, 72 °C por 20 seg com 40 ciclos. Foram realizadas análises de curva de fusão para verificar a especificidade de sua amplificação. Os valores de expressão de todos os genes-alvo de cada amostra foram calculados normalizando com GAPDH controle interno, e calculados utilizando o método 2-ΔΔCT.
Western Blot
Células H9c2 foram centrifugadas por tripsinização por 5 min a 1.000 x g e lavadas com PBS frio. Em seguida, as células H9c2 foram ressuspensas em tampão de lise com inibidores de protease e fosfatase. O lisado celular foi mantido em gelo e agitado no vórtex. Depois da centrifugação por 20 a 13,000×g, o sobrenadante foi separado e armazenado a −80 °C até o uso. Depois da desnaturação, 20μg de proteína total foram colocados em eletroforese em gel de acrilamida contendo dodecil sulfato de sódio 12% (SDS-PAGE), e foram transferidos por eletroforese para uma membrana de fluoreto de polivinilideno (PVDF). Depois do bloqueio com TBST (50mM Tris-HCl, pH 8;154 mM NaCl e 0,1% tween20) por 2 horas em temperatura ambiente, as membranas foram testadas com anticorpos específicos em relação a ALAS1 (diluição,1:1.000; policlonal de coelho; nº cat. 16200-1-AP; Proteintech), ALAS2 (diluição,1:1.000; policlonal de coelho; nº cat. ab136799; Abcam), HOX-1 (diluição,1:1.000; policlonal de coelho; nº cat. ab230513; Abcam), HOX-2(diluição,1:500; policlonal de coelho; nº cat. ab229960; Abcam) e GAPDH (diluição, 1:1.000; clone 6C5; cat. no. ab8245; Abcam) durante a noite a 4°C. Anticorpos secundários titulados com Horseradish peroxidase (HRP) (1:1.000 diluição; nº cat. A0208, A0216; Beyotime) foram acrescentados, após a incubação em temperatura ambiente por 2 horas. As membranas foram visualizadas com kits de quimioluminescência amplificada (Biorbyt, Ltd., Cambridge, Reino Unido). Para quantificar a expressão de proteína direcionada, os filmes de raio X foram escaneados, e as intensidades de banda foram quantificadas pelo software ImageJ 1.47. Os resultados foram normalizados em GAPDH.
Medição de heme intracelular
O ensaio de imunoabsorção enzimática (ELISA) foi utilizado para determinar os níveis de heme intracelular. As células H9c2 de cada grupo foram lisadas e submetidas a centrifugação a 12000rpm por 15 minutos a 4 °C para retirar detritos. A concentração de proteína do lisado celular foi quantificada pelo kit de Ensaio de Proteína BCA (Beyotime). O heme nos lisados celulares de H9c2 foi medido utilizando-se o Ensaio Heme QuantiChrom (BioAssay Systems), seguindo o protocolo do fabricante e normalizado a uma concentração de proteína de cada amostra.
Citometria de fluxo para determinar o índice de apoptose em células H9c2
A apoptose foi avaliada utilizando-se o kit Annexin V-FITC/PI Apoptosis Detection kit (KeyGEN, China) de acordo com o protocolo do fabricante. Depois da intervenção, aproximadamente 1×105 células H9c2 de cada grupo foram lavadas, digeridas com tripsina e as células ressuspensas com 1x PBS (4°C), centrifugadas a 2.000 rpm por 5-10 minutos para lavar as células. As células foram ressuspensas em 500μl do tampão, seguido da adição de 5 μl de Annexin V-FITC e 5 μl de PI. As células foram incubadas no escuro por 15 minutos em temperatura ambiente. Em seguida, as células de cada grupo foram examinadas quanto ao índice de apoptose por citometria de fluxo (BD Accuri™ C6), e o experimento foi repetido três vezes. O índice de apoptose foi quantificado como a porcentagem de células coradas com Annexin V.
Análise estatística
Os dados no presente estudo são normalmente distribuídos, o que foi verificado pelo teste de Shapiro-Wilk, e são expressos como média ± SD. A ANOVA de fator único, seguida do teste post hoc de Tukey, foi usada para examinar a significância estatística das diferenças entre os grupos. A análise estatística foi realizada utilizando-se o software SPSS 24.0 Statistical Package Program for Windows (SPSS Inc., Chicago, IL, EUA). Um p-valor bilateral de <0,01 foi considerado estatisticamente significativo.
ResultadosAlterações nos níveis de heme em células H9c2 com concentrações diferentes de doxorrubicina
Conforme mostrado na Figura 1, em comparação com o grupo de controle (5088,4±153,1ng/ml), os níveis de heme das células H9c2 foram significativamente regulados para cima 1,27 vezes (6493,1±138,8 ng/ml), 1,56 vezes (7498,9±110,2ng/ml), e no máximo um aumento de 2,34 vezes (11896,6±187,3ng/ml) nos grupos com 1μM, 2μM, e 5μM de doxorrubicina, separadamente (p<0,01). Essa tendência à regulação para cima passou a ter um aumento de 1,95 vezes (9911,9±286,8ng/ml) no grupo com 10μM de doxorrubicina, em comparação com grupo de controle (p<0,01).
– Efeitos da doxorrubicina nos níveis de heme nas células H9c2 exposta a solução salina (grupo de controle) ou doxorrubicina com concentração diferente por 24 horas. Níveis de heme medidos por ELISA. Os dados são apresentados como média±desvio padrão. *p<0,01, em comparação ao grupo de controle.
Efeitos da doxorrubicina nos índices de apoptose de células H9c2
A análise de citometria de fluxo demonstrou que, em comparação com o grupo de controle tratado com solução salina, o índice de apoptose de células H9c2 tratadas com concentrações diferentes de doxorrubicina aumentou significativamente, conforme mostrado na Figura 2. Quando incubado com 1,2,5, e 10μM de doxorrubicina por 24 horas, o índice total de apoptose, incluindo a apoptose de estágio inicial e final, de H9c2 foi aumentado para 10,6±1,6%, 41,1±1,9%, 60,5±3,6%, e 76,0±2,5% respectivamente, em comparação com 2,1±0,5% no grupo de controle (p<0,01).
– Análise por citometria de fluxo dos efeitos da doxorrubicina na viabilidade das células H9c2 As células H9c2 foram pré-tratadas com solução salina (controle) e doxorrubicina a 1,2,5 e 10μM respectivamente por 24h. (A) Análises representativas de citometria de fluxo de cinco experimentos separados correspondentes ao controle a às várias concentrações de tratamento com doxorrubicina, respectivamente. (B) Gráfico estatístico de coloração annexin V-FITC/PI. Resultados expressos como média±desvio padrão. *p<0,01, em comparação ao grupo de controle.
Regulação da sintase do ácido aminolevulínico 1 (ALAS1) e da sintase do ácido aminolevulínico 2 (ALAS2) expressão de RNA mensageiro (mRNA) em células H9c2 depois do tratamento com doxorrubicina
Como primeiro passo, foram avaliadas as enzimas limitantes de velocidade da síntese do heme que ocorre nas mitocôndrias, a expressão do mRNA da ALAS1 e ALAS2 em tratamento com doxorrubicina. Depois da incubação com 1μM e 2μM doxorrubicina, as expressões de mRNA no ALAS1 foram reguladas para baixo (embora não sejam estatisticamente significativos). Depois de tratar com 5μM e 10μM de doxorrubicina, as expressões de mRNA de ALAS1 foram estatisticamente aumentadas até 41,1 vezes 375,3 vezes, em comparação com o grupo de controle separadamente. Diferente da ALAS1, a expressão de mRNA de ALAS2 demonstrou um uma regulação para baixo significativa (grupo 1μM:0,88 vezes, grupo 2μM: 0,83vezes, grupo de 5μM: 0,49 vezes, grupo 10μM:0,31 vezes respectivamente, conforme mostrado na Figura 3A.)
– (A) alteração da expressão de mRNA de ALAS1 e ALAS2 em tratamento com doxorrubicina. sintase do ácido aminolevulínico 1; ALAS2, sintase do ácido aminolevulínico 2. (B) Características da alteração da expressão de mRNA para enzimas catabólicas do heme em tratamento com doxorrubicina. HOX-1, heme oxigenase 1; HOX-2, heme oxigenase2. * indica p<0,01 versus grupo de controle.
Regulação da expressão do mRNA para as HOX-1 e HOX-2 em células H9c2 após o tratamento com doxorrubicina
Foram examinadas as enzimas citoplasmáticas limitantes de velocidade in catabolismo do heme, HOX-1, e HOX-2. Detectamos que, depois de incubado com um nível crescente de doxorrubicina, o mRNA de HOX-1 e HOX-2 exibiu o mesmo padrão de regulação, embora com níveis de alteração diferenciados. Não houve alteração significativa na expressão do mRNA depois do tratamento com 1μM e 2μM, comparado com o grupo de controle, nem em HOX-1, nem HOX-2. Depois de incubado com 5μM de doxorrubicina, a expressão de mRNA para HOX-1 e HOX-2 se regularam para uma mudança para cima de 4,3 vezes e 15,5 vezes, respectivamente (p<0,01). Entretanto, após o tratamento com 10μM de doxorrubicina, a regulação para cima diminuiu até o nível de 2,6 vezes e 3,2 vezes separadamente, em comparação com o grupo de controle, (p<0,01), conforme mostrado na Figura 3B
Regulação dos níveis de proteína de ALAS1, ALAS2, HOX-1, e HOX-2 após o tratamento com doxorrubicina
A análise de Western Blot demonstrou que, de forma idêntica ao padrão de expressão de mRNA, os níveis de proteína ALAS1 foram regulados para baixo significativamente no grupo de 2μM de doxorrubicina, e regulado para cima no grupo de 10μM de doxorrubicina, em comparação com o grupo de controle. Observou-se que os níveis de proteína foram regulados para baixo progressivamente, à medida que a concentração de doxorrubicina aumentou de 1μM a 10μM, conforme mostrado na Figura 4A.
– Análise de dados de Western Blot para alterações de níveis de proteína ALAS (A) e HOX (B) em células H9c2 em concentrações de doxorrubicina diferentes. ALAS1: sintase do ácido aminolevulínico 1; ALAS2: sintase do ácido aminolevulínico; HOX-1: heme oxigenase 1; HOX-2: heme oxigenase 2. Cada teste Western Blot foi realizado três vezes. * indica p<0,01 versus grupo de controle.
A expressão de proteína de HOX-1 foi ligeiramente regulada para baixo no tratamento com 1μM e 2μM de doxorrubicina, e depois regulada para cima de forma abrupta, em comparação com o grupo de controle. No entanto, de forma inconsistente com o padrão de expressão de mRNA, detectamos um aumento progressivo no nível de proteína HOX-2 com o aumento da concentração de doxorrubicina de 1μM a 5μM, e, em seguida, voltou para o nível de linha de base quando tratado com 10μM de doxorrubicina (Figura 4B).
Discussão
Doxorrubicina é um tipo de droga antraciclina que é uma droga antitumoral eficiente de amplo espectro. Ela é amplamente utilizada no tratamento de vários tumores malignos, tais como câncer de mama, câncer de pulmão e linfoma.5 Entretanto, os efeitos cardíacos tóxicos da doxorrubicina na dose clínica para quimioterapia são graves e dependem da dose, o que pode levar a cardiomiopatia e insuficiência cardíaca congestiva, e, portanto, limitam muito seu uso clínico.6 Diferente do mecanismo de sua atividade antitumoral, o mecanismo primário de toxicidade cardíaca induzido pela doxorrubicina, é a geração de espécies reativas do oxigênio (ERO) e a promoção subsequente do stress oxidativo miocárdico.7 O heme é um mediador essencial da disponibilidade bioquímica do ferro.8 A função da molécula do heme varia de acordo com a proteína ligante com a qual é coordenado. Ele pode funcionar como mediador de transporte e armazenamento de oxigênio em hemoglobina9 ou mioglobina,10 e, por outro lado, ele age como um transportador de elétrons em citocromos, e é a fonte crítica de ferro redox-ativo.11 Bhoite-Solomon et al. identificaram que o heme livre é tóxico para o miocárdio, e causa citólise por meio de dano no sarcolema, dependendo da concentração.12 Além dos cardiomiócitos, o heme livre também pode ser tóxico às células epiteliais humanas e a células semelhantes a neurônios,13,14por meio do stress oxidativo causado pela apoptose ou necrose da célula. Além disso, o heme livre pode causar dano celular endotelial, ao estimular a expressão de fatores inflamatórios.15,16
Entretanto, diferentemente dos vários estudos sobre dano oxidativo a cardiomiócitos mediados por ferro tratados com drogas antraciclinas, a variação do nível de heme intracelular e a regulação dos processos de sua síntese e metabolismo não foram bem avaliados no cardiomiócito em tratamento com antraciclina. No presente estudo, examinamos sistematicamente as características de variação de enzimas biossintéticas e degradadoras do heme pela primeira vez.
No caminho de biossíntese, há oito enzimas envolvidas, dentre as quais quatro são enzimas mitocondriais, e quatro são enzimas citoplasmáticas.17 Na primeira etapa da síntese do heme, a glicina e succinil coenzima A são condensadas no ácido δ-aminolevulínico (ALA). Essa reação precisa ser catalisada pela sintase do ácido aminolevulínico (ALAS).18 Há dois tipos de ALAS: ALAS1 e ALAS2. A primeira tem uma expressão universal, enquanto a última é predominantemente expressa em células precursoras de hemácias.19 No presente estudo, observamos que não apenas a ALAS1, mas também a ALAS2 foram expressas nas células H9c2 em níveis de linha de base. Após o tratamento com doxorrubicina, a expressão de mRNA de ALAS1 e ALAS2 apresentam dois padrões de alteração distintos. A expressão de proteína e mRNA de ALAS1, a princípio, apresentou uma tendência à inibição (embora não fosse estatisticamente significativa em nosso estudo) com 1μM e 2μM de doxorrubicina, e, depois, padrões dramáticos de regulação para cima com o tratamento com 5μM e 10μM de doxorrubicina.
Por outro lado, a expressão de proteína e mRNA de ALAS2 foi suprimida gradativamente até o nível mais baixo, quando tratada com 10μM de doxorrubicina, com 69,0% e 35,0% de redução, respectivamente. Esse fenômeno indica que, sob o efeito da doxorrubicina, a regulação de ALAS1 e ALAS2 pode tomar caminhos diferentes e ter objetivos de bioprocessos direcionadores diferentes. A regulação para baixo de ALAS2 pode ser explicada pelo feedback negativo de uma elevação progressiva do nível de heme. Esse efeito pode ser alcançado reprimindo-se a transcrição de mRNA de ALAS2, conforme mostrado em nossos resultados de PCR em tempo real, bem como interrompendo-se a formação de ALAS2 por meio de um bloco do precursor de ALAS2 até as mitocôndrias.20,21 Nas hemácias, a expressão de ALAS2 é determinada pela transativação de locais de fatores nucleares GATA-1, CACC box, e NF-E2-ligante na área promotora, e sua síntese é regulada pela quantidade de ferro livre.22 Entretanto, os mecanismos de regulação de ALAS2 em cardiomiócitos em tratamento com doxorrubicina precisa ser pesquisada mais a fundo.
Em nosso estudo, ALAS1, que deveria estar estritamente em controle de feedback negativo em nível baixo para evitar o alto nível citotóxico de heme, foi expresso excessivamente nos aspectos do gene e da proteína, apesar do alto nível de heme que existe simultaneamente. Podvinec et al.,23 relataram que as drogas que induzem citocromos P450 e outras enzimas associadas que metabolizam drogas podem fazer a regulação para cima de ALAS1 simultaneamente e por meio de transcrição, que foi o primeiro passo na síntese de heme, para coordenar com a necessidade de atividade de citocromo P450 com regulação para cima. Esse processo foi mediado por dois elementos aperfeiçoadores, localizados a 20 e 16 kb a montante do local de início transcricional de ALAS1, e sua interação com os xeno-receptores NR1I2 e NR1I3.23 Zordoky et al.,24 revelaram que a doxorrubicina causa indução significativa de vários genes P450 do citocromo, tais como expressão genética de CYP1A1, CYP1A2, CYP1B1, e CYP2B2 dependendo da concentração. NR1I2 e NR1I3 também demonstraram ser os receptores nucleares cruciais que mediaram a interação entre a doxorrubicina e as enzimas metabolizantes.25 Os mecanismos precisos de regulação de padrões de expressão de ALAS no cardiomiócito precisará ser elucidado em estudos futuros.
A heme oxidase (HOX) é a enzima limitante de velocidade no processo de degradação do heme, que pode degradar por oxidação a molécula do heme para produzir monóxido de carbono, ferro e biliverdina. A heme oxidase tem duas isoenzimas, heme oxidase 1 (HOX-1) e heme oxidase 2 (HOX-2). A HOX-2 desempenha basicamente um papel regulatório sob condições fisiológicas normais, enquanto a HOX-2 pode proteger as células e os tecidos em stress oxidativo.26
A expressão de HOX-1 pode ser promovida por uma variedade de estímulos, incluindo a doxorrubicina27 e o acúmulo de heme intracelular. Estudos anteriores revelaram que a expressão de HO-1 é regulada principalmente no nível da transcrição, e identificou-se que vários elementos regulatórios têm um papel importante na regulação para cima da HOX-1, incluindo elementos de resposta metal (MREs), elementos de resposta ao stress (StREs), AP-1, e NF-B.28 Por outro lado, demonstrou-se que Bach1 tem um efeito repressor na expressão de HOX-1.29 No presente estudo, identificamos que a HOX-1 nos cardiomiócitos de H9c2 foi inicialmente regulada para baixo quando tratada com baixa concentração de doxorrubicina (1μM e 2 μM) nas células H9c2 e, em seguida significativamente regulada para cima com incubação com 5μM e 10μM de doxorrubicina. Nossa pesquisa indica que serão necessários mais estudos com foco na interação entre vários reguladores de e elementos de gene da HOX-1 em concentrações diferentes de doxorrubicina.
Apesar de apresentar padrão semelhante ao da expressão de mRNA com HOX-1, o nível de proteína da HOX-2 foi elevado progressivamente juntamente com o aumento de concentração de doxorrubicina de 1μM a 5μM, e baixou abruptamente abaixo do nível de linha de base quando tratado com 10μM de doxorrubicina. A diferença no perfil de alteração do nível de proteína entre HOX-1 e HOX-2 pode ser devida à diferença em seus mecanismos de regulação.30,31 Em ratos, a expressão de HO-2 é modulada por glicocorticoides, por meio do elemento de resposta do glicocorticoide (GRE).32 Até onde sabemos, este é o primeiro estudo sobre o efeito da doxorrubicina na expressão de HOX-2 em cardiomiócitos. Entretanto, o mecanismo de ação preciso entre a doxorrubicina e a regulação de HOX-2 ainda é uma questão crítica não resolvida.
Limitações do estudo
Falta de resultados na detecção de atividades de enzimas em células H9c2 era considerado como a principal limitação de nosso estudo. Enquanto isso, o nível de stress oxidativo, de acordo com a alteração do metabolismo de heme não foi explorada, o que pode elucidar melhor a relação entre enzimas metabólicas do heme e cardiotoxicidade induzida por doxorrubicina. Mais estudos cobrindo esses aspectos são necessários para esclarecer o efeito da doxorrubicina na biossíntese e no metabolismo do heme.
Conclusões
O aumento da expressão de ALAS1 pode ter um papel na elevação do nível do heme quando o cardiomiócito H9c2 for exposto à doxorrubicina. Embora as HOX tenham sido reguladas para cima em concentrações de doxorrubicina de moderada a alta, seus efeitos degradadores foram sufocados pela ativação da síntese do heme não controlada. Os mecanismos específicos para a perda de controle de feedback negativo na formação do heme em tratamento com doxorrubicina, e o papel possível das ALAS como alvo terapêutico contra a citotoxicidade por heme induzida por doxorrubicina deverá ser estudada em investigações futuras.
Referências1. Barbar T, Mahmood SS, Liu JE. Cardiomyopathy Prevention in Cancer Patients. Cardiol Clin. 2019 Nov;37(4):441-7.BarbarTMahmoodSSLiuJECardiomyopathy Prevention in Cancer PatientsCardiol Clin2019113744414472. Cuomo A, Rodolico A, Galdieri A, Russo M, Campi G, Franco R, et al. Heart Failure and Cancer: Mechanisms of Old and New Cardiotoxic Drugs in Cancer Patients. Card Fail Rev. 2019 May 24;5(2):112-8.CuomoARodolicoAGaldieriARussoMCampiGFrancoRet alHeart Failure and Cancer: Mechanisms of Old and New Cardiotoxic Drugs in Cancer PatientsCard Fail Rev20190524521121183. Sansbury BE, DeMartino AM, Xie Z, Brooks AC, Brainard RE, Watson LJ, et al Metabolomic analysis of pressure-overloaded and infarcted mouse hearts. Circ Heart Fail. 2014;7:634–42.SansburyBEDeMartinoAMXieZBrooksACBrainardREWatsonLJet alMetabolomic analysis of pressure-overloaded and infarcted mouse heartsCirc Heart Fail201476346424. Khechaduri A, Bayeva M, Chang HC, Ardehali H. Heme levels are increased in human failing hearts. J Am Coll Cardiol. 2013;61:1884–93.KhechaduriABayevaMChangHCArdehaliHHeme levels are increased in human failing heartsJ Am Coll Cardiol201361188418935. Rivankar S .An overview of doxorubicin formulations in cancer therapy. J Cancer Res Ther. 2014 Oct-Dec;10(4):853-8.RivankarSAn overview of doxorubicin formulations in cancer therapyJ Cancer Res Ther2014Oct-Dec1048538586. Liu H, Wang H, Xiang D, Guo W. Pharmaceutical Measures to Prevent Doxorubicin-Induced Cardiotoxicity. Mini Rev Med Chem. 2017;17(1):44-50.LiuHWangHXiangDGuoWPharmaceutical Measures to Prevent Doxorubicin-Induced CardiotoxicityMini Rev Med Chem201717144507. Cappetta D, De Angelis A, Sapio L, Prezioso L, Illiano M, Quaini F, Rossi F, et al. Oxidative Stress and Cellular Response to Doxorubicin: A Common Factor in the Complex Milieu of Anthracycline Cardiotoxicity. Oxid Med Cell Longev. 2017;2017:1521020.CappettaDDe AngelisASapioLPreziosoLIllianoMQuainiFRossiFet alOxidative Stress and Cellular Response to Doxorubicin: A Common Factor in the Complex Milieu of Anthracycline CardiotoxicityOxid Med Cell Longev2017201715210208. Gao G, Li J, Zhang Y, Chang YZ. Cellular Iron Metabolism and Regulation. Adv Exp Med Biol. 2019;1173:21-32.GaoGLiJZhangYChangYZCellular Iron Metabolism and RegulationAdv Exp Med Biol2019117321329. Kafina MD, Paw BH. Intracellular iron and heme trafficking and metabolism in developing erythroblasts. Metallomics. 2017;9(9):1193-203.KafinaMDPawBHIntracellular iron and heme trafficking and metabolism in developing erythroblastsMetallomics2017991193120310. Postnikova GB, Shekhovtsova EA. Myoglobin: Oxygen Depot or Oxygen Transporter to Mitochondria? A Novel Mechanism of Myoglobin Deoxygenation in Cells (review). Biochemistry (Mosc). 2018 Feb;83(2):168-83.PostnikovaGBShekhovtsovaEAMyoglobin: Oxygen Depot or Oxygen Transporter to Mitochondria? A Novel Mechanism of Myoglobin Deoxygenation in Cells (review)Biochemistry (Mosc)20180283216818311. Yanatori I, Richardson DR, Toyokuni S, Kishi F. How iron is handled in the course of heme catabolism: Integration of heme oxygenase with intracellular iron transport mechanisms mediated by poly (rC)-binding protein-2. Arch Biochem Biophys. 2019 Sep 15;672:108071.YanatoriIRichardsonDRToyokuniSKishiFHow iron is handled in the course of heme catabolism: Integration of heme oxygenase with intracellular iron transport mechanisms mediated by poly (rC)-binding protein-2Arch Biochem Biophys2019091567210807112. Bhoite-Solomon V1, Kessler-Icekson G, Shaklai N. Myocyte injury by hemin. In Vitro Cell Dev Biol Anim. 1993;29A (8):636-42.Bhoite-SolomonV1Kessler-IceksonGShaklaiNMyocyte injury by heminIn Vitro Cell Dev Biol Anim199329A863664213. Nath KA, Balla J, Croatt AJ, Vercellotti GM. Heme protein-mediated renal injury: a protective role for 21-aminosteroids in vitro and in vivo. Kidney Int. 1995;47(2):592-602.NathKABallaJCroattAJVercellottiGMHeme protein-mediated renal injury: a protective role for 21-aminosteroids in vitro and in vivoKidney Int199547259260214. Goldstein L, Teng ZP, Zeserson E, Patel M, Regan RF. Hemin induces an iron-dependent, oxidative injury to human neuron-like cells. J Neurosci Res. 2003;73(1):113-21.GoldsteinLTengZPZesersonEPatelMReganRFHemin induces an iron-dependent, oxidative injury to human neuron-like cellsJ Neurosci Res200373111312115. Merle NS, Grunenwald A, Rajaratnam H, Gnemmi V, Frimat M, Figueres ML, et al. Roumenina LT1,2,Intravascular hemolysis activates complement via cell-free heme and heme-loaded microvesicles. JCI Insight. 2018 Jun 21;3(12). pii: 96910.MerleNSGrunenwaldARajaratnamHGnemmiVFrimatMFigueresMLet alRoumenina LT1,2,Intravascular hemolysis activates complement via cell-free heme and heme-loaded microvesiclesJCI Insight20180621312pii: 9691016. Camus SM, De Moraes JA, Bonnin P, Abbyad P, Le Jeune S, Lionnet F, et al. Circulating cell membrane microparticles transfer heme to endothelial cells and trigger vasoocclusions in sickle cell disease. Blood. 2015 Jun 11;125(24):3805-14.CamusSMDe MoraesJABonninPAbbyadPLe JeuneSLionnetFet alCirculating cell membrane microparticles transfer heme to endothelial cells and trigger vasoocclusions in sickle cell diseaseBlood20150611125243805381417. van der Vorm LN, Paw BH. Studying disorders of vertebrate iron and heme metabolism using zebrafish. Methods Cell Biol. 2017;138:193-220.van der VormLNPawBHStudying disorders of vertebrate iron and heme metabolism using zebrafishMethods Cell Biol201713819322018. Brown BL, Kardon JR, Sauer RT, Baker TA. Structure of the Mitochondrial Aminolevulinic Acid Synthase, a Key Heme Biosynthetic Enzyme. Structure. 2018 Apr 3;26(4):580-9.e4.BrownBLKardonJRSauerRTBakerTAStructure of the Mitochondrial Aminolevulinic Acid Synthase, a Key Heme Biosynthetic EnzymeStructure2018043264580589e419. Chiabrando D, Mercurio S, Tolosano E. Heme and erythropoieis: more than a structural role. Haematologica. 2014 Jun;99(6):973-83.ChiabrandoDMercurioSTolosanoEHeme and erythropoieis: more than a structural roleHaematologica20140699697398320. Lathrop JT, Timko MP. Regulation by heme of mitochondrial protein transport through a conserved amino acid motif. Science. 1993;259(5094):522-5.LathropJTTimkoMPRegulation by heme of mitochondrial protein transport through a conserved amino acid motifScience1993259509452252521. Lane DJ, Merlot AM, Huang ML, Bae DH, Jansson PJ, Sahni S, et al. Cellular iron uptake, trafficking and metabolism: key molecules and mechanisms and their roles in disease. Biochim Biophys Acta Mol Cell Res. 2015;1853:1130–44.LaneDJMerlotAMHuangMLBaeDHJanssonPJSahniSet alCellular iron uptake, trafficking and metabolism: key molecules and mechanisms and their roles in diseaseBiochim Biophys Acta Mol Cell Res201518531130114422. Peoc’h K, Nicolas G, Schmitt C, Mirmiran A, Daher R, Lefebvre T, et al. Regulation and tissue-specific expression of δ-aminolevulinic acid synthases in non-syndromic sideroblastic anemias and porphyrias. Mol Genet Metab. 2019 Jan 23. pii: S1096-7192(18)30632-2.Peoc’hKNicolasGSchmittCMirmiranADaherRLefebvreTet alRegulation and tissue-specific expression of δ-aminolevulinic acid synthases in non-syndromic sideroblastic anemias and porphyriasMol Genet Metab20190123S1096-7192(18)30632-223. Podvinec M, Handschin C, Looser R, Meyer UA. Identification of the xenosensors regulating human 5-aminolevulinate synthase. Proc Natl Acad Sci U S A. 2004;101(24):9127-9132.PodvinecMHandschinCLooserRMeyerUAIdentification of the xenosensors regulating human 5-aminolevulinate synthaseProc Natl Acad Sci U S A2004101249127913224. Zordoky BN, El-Kadi AO. Induction of several cytochrome P450 genes by doxorubicinorubicin in H9c2 cells. Vascul Pharmacol. 2008 ;49(4-6):166-72.ZordokyBNEl-KadiAOInduction of several cytochrome P450 genes by doxorubicinorubicin in H9c2 cellsVascul Pharmacol2008494-616617225. Hedrich WD, Hassan HE, Wang H. Insights into CYP2B6-mediated drug-drug interactions. Acta Pharm Sin B. 2016 Sep;6(5):413-25.HedrichWDHassanHEWangHInsights into CYP2B6-mediated drug-drug interactionsActa Pharm Sin B2016096541342526. Muñoz-Sánchez J, Chánez-Cárdenas ME. A review on hemeoxygenase-2: focus on cellular protection and oxygen response. Oxid Med Cell Longev. 2014;2014:604981.Muñoz-SánchezJChánez-CárdenasMEA review on hemeoxygenase-2: focus on cellular protection and oxygen responseOxid Med Cell Longev2014201460498127.Zhu XF, Li W, Ma JY, Shao N, Zhang YJ, Liu RM, et al. Knockdown of heme oxygenase-1 promotes apoptosis and autophagy and enhances the cytotoxicity of doxorubicin in breast cancer cells. Oncol Lett. 2015 Nov;10(5):2974-80.ZhuXFLiWMaJYShaoNZhangYJLiuRMet alKnockdown of heme oxygenase-1 promotes apoptosis and autophagy and enhances the cytotoxicity of doxorubicin in breast cancer cellsOncol Lett2015111052974298028. Morse D, Choi AM. Heme oxygenase-1: the “emerging molecule” has arrived. Am J Respir Cell Mol Biol. 2002 Jul;27(1):8-16.MorseDChoiAMHeme oxygenase-1: the “emerging molecule” has arrivedAm J Respir Cell Mol Biol20020727181629. Kitamuro T, Takahashi K, Ogawa K, Udono-Fujimori R, Takeda K, Furuyama K, et al. Bach1 functions as a hypoxia-inducible repressor for the heme oxygenase-1b gene in human cells. J Biol Chem. 2003 Mar 14;278(11):9125-33.KitamuroTTakahashiKOgawaKUdono-FujimoriRTakedaKFuruyamaKet alBach1 functions as a hypoxia-inducible repressor for the heme oxygenase-1b gene in human cellsJ Biol Chem20030314278119125913330. Dunn LL, Midwinter RG, Ni J, Hamid HA, Parish CR, Stocker R. New insights into intracellular locations and functions of heme oxygenase-1. Antioxid Redox Signal. 2014;20:1723–42.DunnLLMidwinterRGNiJHamidHAParishCRStockerRNew insights into intracellular locations and functions of heme oxygenase-1Antioxid Redox Signal2014201723174231. Intagliata S, Salerno L, Ciaffaglione V, Leonardi C, Fallica AN, Carota G, et al. Heme Oxygenase-2 (HO-2) as a therapeutic target: Activators and inhibitors. Eur J Med Chem. 2019 Dec 1;183:111703.IntagliataSSalernoLCiaffaglioneVLeonardiCFallicaANCarotaGet alHeme Oxygenase-2 (HO-2) as a therapeutic target: Activators and inhibitorsEur J Med Chem201912118311170332. Liu N, Wang X, McCoubrey WK, Maines MD. Developmentally regulated expression of two transcripts for heme oxygenase-2 with a first exon unique to rat testis: control by corticosterone of the oxygenase protein expression. Gene. 2000 Jan 4;241(1):175-83.LiuNWangXMcCoubreyWKMainesMDDevelopmentally regulated expression of two transcripts for heme oxygenase-2 with a first exon unique to rat testis: control by corticosterone of the oxygenase protein expressionGene20000142411175183
Vinculação acadêmica
Não há vinculação deste estudo a programas de pós-graduação.
Aprovação ética e consentimento informado
Este artigo não contém estudos com humanos ou animais realizados por nenhum dos autores.
Fontes de financiamento.O presente estudo foi financiado pela Beijing Municipal Natural Science Foundation (Grant nº 7162089).
Original ArticleEffects of Doxorubicin on Heme Biosynthesis and Metabolism in CardiomyocyteWangZuoyan1GaoJunyi1TengHaobo10000-0002-0068-8728PengJianjun1ChinaCapital Medical University Affiliated Beijing Shijitan Hospital, Beijing - ChinaMailing Address: Jianjun Peng • Capital Medical University Affiliated Beijing Shijitan Hospital - No.10 Tieyi Road, Haidian District, Beijing, 100038, China Beijing 100038 E-mail: pengjianjun2361@bjsjth.cn
Author contributions
Conception and design of the research and Writing of the manuscript: Wang Z; Acquisition of data and Statistical analysis: Wang Z, Gao J, Teng H; Analysis and interpretation of the data and Critical revision of the manuscript for intellectual content: Wang Z, Peng J.
Potential Conflict of Interest
No potential conflict of interest relevant to this article was reported.
AbstractBackground
Doxorubicin is associated with cardiotoxicity and late cardiac morbidity. Heme is related to cellular oxidative stress. However, its specific regulation in cardiomyocytes under doxorubicin effects has not yet been documented.
Objective
This study seeks to evaluate the changing profiles of rate-limiting enzymes in the heme metabolism pathway under the effect of doxorubicin.
Methods
H9c2 cardiomyocytes were incubated with doxorubicin at different concentrations (1,2,5,10μM respectively). The real-time PCR and Western Blot were used to determine the mRNA and protein expression for four pivotal enzymes (ALAS1, ALAS2, HOX-1, and HOX-2) regulating cellular heme metabolism, as well as the levels of heme were detected by ELISA. p<0.01 was considered significant.
Results
This study observed a dose-dependent changing pattern in heme levels in H9c2 cells with the highest level at the 5μM concentration for doxorubicin, which occurred synchronously with the highest upregulation level of ALAS1, as well as the degradative enzymes, HOX-1, and HOX-2 in mRNA and protein expression. By contrast, ALAS2, contrary to the increasing concentrations of doxorubicin, was found to be progressively down-regulated.
Conclusion
The increase in ALAS1 expression may play a potential role in the heme level elevation when H9c2 cardiomyocyte was exposed to doxorubicin and may be a potential therapeutic target for doxorubicin-induced myocardial toxicity. (Arq Bras Cardiol. 2021; 116(2):315-322)
With the continuing progression of anti-tumor drugs and radiotherapy, the survival rate of patients with malignant tumors has been improved, and their survival-span is significantly prolonged. However, the widespread use of anti-tumor drugs is accompanied by an increase in cardiovascular adverse events, which affects patient survival and quality of life. Anthracyclines are drugs derived from streptomycin, including doxorubicin, and epirubicin, which are widely used to treat breast cancer, small cell lung cancer, myeloma, sarcoma, lymphoma, and leukemia. Myocardiopathy and subsequent heart failure are the most serious manifestation of cardiotoxicity caused by anthracycline drugs in chemotherapy. Moreover, the cardiovascular toxicity of anthracyclines is dose-dependent and irreversible.1,2
The exact mechanism of anthracycline drugs that induced myocardial toxicity remains unclear, though a variety of theories have been proposed, including the inhibition of DNA replication and RNA transcription, DNA damage caused by free radicals, lipid peroxidation and alkylation, DNA cross-linking, interference with DNA unwinding, inhibition of topoisomerase Ⅱ, among others.
Heme is an important porphyrin ligand, as a supplement of the heme protein, and is responsible for the physiological function of O2 transport in the body. Many biological functions related to life, such as electron transport, oxygen storage, signal transduction, and gene expression are controlled by different heme proteins. Recent studies found that heme levels increased significantly in rat models of myocardial ischemic heart failure, suggesting that heme may play an important role in ischemic and hypoxic myocardial injury.3,4 However, there has been no published literature that specifically explored the changing of heme biosynthesis or metabolism in cardiomyocyte under anthracyclines treatment.
Heme biosynthesis is initiated by the formation of 5-aminolevulinic acid (ALA) from glycine (Gly) and succinyl-CoA, catalyzed by ALA synthase (ALAS), which has two isoenzymes: ALAS1 and ALAS2. On the other hand, heme oxygenase (HOX) mediates the first step of heme catabolism, and it cleaves heme to form biliverdin. Two active isoforms of HOX have been identified: the inducible HOX-1 and the less regulated HOX-2.
The purpose of this study was to elucidate the changing profiles of four pivotal enzymes, aminolaevulinic acid synthase 1 (ALAS1), aminolaevulinic acid synthase 2 (ALAS2), heme oxygenase 1 (HOX-1), and heme oxygenase 2 (HOX-2), in H9c2 cardiomyocyte under doxorubicin treatment.
MethodsCell culture and doxorubicin treatment
H9c2 cardiomyocytes were purchased from American Type Culture Collection (ATCC, Manassas, VA)and then cultured with DMEM/F12 medium containing 10% fetal bovine serum and 1% double-antibody medium, under the conditions of 37°C and 5% CO2 in a humidified chamber. The H9c2 cells were then plated onto 6-well plates at 2 × 105 cells/well in a volume of 2 mL and cultured in DMEM/F12 medium containing 10% fetal bovine serum for 24 h. After, different doses of doxorubicin (1,2,5,10 μM, respectively) were added to the plate well. The doxorubicin-untreated cells (treated with saline) represented the control group. After a 24h-incubation at 37ºC, the cells of different wells were harvested separately by centrifugation (10,000 rpm for 10 minutes at 4°C) and used for further study below.
Quantitative real-time PCR
Total RNA was extracted from H9c2 cells of all the groups, using TRIzol (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA) and reverse transcribed with the SuperScript Double-Strand Synthesis kit (Invitrogen; Thermo Fisher Scientific, Inc.), according to the manufacturer’s instructions, and amplified on a 7500 Fast real-time PCR system with SYBR GreenER qPCR SuperMix Universal (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA). Primers used for amplification of ALAS1, ALAS2, HOX-1, and HOX-2 were designed using Primer3 (v. 0.4.0) software. The following primers were used for real-time PCR:
ALAS1-F:TTGCCAAAGTCCGTTTCC
R: TGTAGTCATCTGCCATAGGG 3’;
ALAS2-F: TCAAGGGAGAGGAGGGTCAAG
R: ACGAGGCACAGTTGGGTAG
HOX-1-F:TCGACAACCCCACCAAGTT
R:CTGGCGAAGAAACTCTGTCT
HOX-2-F:GCTTACACTCGTTACATGGG
R: CACATGCTCGAACAGGTAGA
GAPDH-F: GATGACATCAAGAAGGTGGTGA
R:ACCCTGTTGCTGTAGCCATATTC.
The reaction conditions were as follows: 95°C for 3 min; 95°C for 30 sec, 55°C for 20sec, and 72°C for 20sec with 40 cycles. Melting curve analyses were performed to verify their amplification specificity. The expression values of all targeted genes from each sample were calculated by normalizing with internal control GAPDH and calculated using the 2-ΔΔCT method.
Western Blot
H9c2 cells were trypsinized, centrifuged for 5 min at 1,000 x g and washed with cold PBS. The H9c2 cells were then resuspended in lysis buffer with protease and phosphatase inhibitors. The cell lysate was kept in ice and vortexed. After centrifugation for 20 min at 13,000×g, the supernatant was separated and stored at −80 °C until use. After denaturation, 20μg of total protein were loaded onto 12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) gels for protein separation, and electrophoretically transferred to a polyvinylidene difluoride (PVDF) membrane. After blocking with 5%milk in TBST (50mM Tris-HCl, pH 8;154 mM NaCl and 0.1% tween20) for 2 hours at room temperature, the membranes were probed with specific antibodies against ALAS1 (dilution,1:1,000; rabbit polyclonal; cat. no. 16200-1-AP; Proteintech), ALAS2 (dilution,1:1,000; rabbit polyclonal; cat. no. ab136799; Abcam), HOX-1 (dilution,1:1,000; rabbit polyclonal; cat. no. ab230513; Abcam), HOX-2 (dilution,1:500; rabbit polyclonal; cat. no. ab229960; Abcam), and GAPDH (dilution, 1:1,000; clone 6C5; cat. no. ab8245; Abcam) overnight at 4°C. Horseradish peroxidase (HRP)-labeled secondary antibodies (1:1,000 dilution; cat.nos. A0208, A0216; Beyotime) was added, followed by incubation at room temperature for 2 h. Membranes were visualized by enhanced chemiluminescence kits (Biorbyt, Ltd., Cambridge, UK). To quantify the targeting protein expression, the X-ray films were scanned, and band intensities were quantified by ImageJ 1.47 software. The results were normalized to GAPDH.
Intracellular heme measurement
Enzyme-linked immune sorbent assay (ELISA) was employed to determine intracellular heme levels. H9c2 cells of each group were lysed and followed by centrifugation at 12,000 rpm for 15 minutes at 4°C to remove debris. The protein concentration of the cell lysate was quantified by an enhanced BCA Protein Assay kit (Beyotime). The heme in H9c2 cell lysates was measured by using QuantiChrom Heme Assay (BioAssay Systems) following the manufacture’s protocol and normalized to a protein concentration of each sample.
Flow cytometry to determine the apoptosis rate in H9c2 cells
Apoptosis was assessed using the Annexin V-FITC/PI Apoptosis Detection kit (KeyGEN, China) according to the manufacturer’s protocol. After the intervention, approximately 1×105 H9c2 cells of each group were washed and digested with trypsin, and then resuspended with 1x PBS (4°C) and centrifuged at 2,000 rpm for 5-10 minutes to wash the cells. The cells were resuspended in 500μl of the buffer, followed by the addition of 5 μl of Annexin V-FITC and 5 μl of PI. The cells were incubated in the dark for 15 minutes at room temperature. Next, the cells of each group were examined for apoptosis rate by flow cytometry (BD Accuri™ C6). The experiment was repeated three times. The apoptotic rate was quantified as the percentage of cells stained with Annexin V.
Statistical Analysis
Data in the present study are normally distributed, which was verified by Shapiro- Wilk test, and are expressed as mean ± SD. One-way ANOVA, followed by Tukey’s post hoc test, was used to examine the statistical significance of differences between groups. Statistical analysis was performed by using the SPSS 24.0 Statistical Package Program for Windows (SPSS Inc., Chicago, IL, USA). A two-sided p-value of <0.01 was considered significant.
ResultsThe changing of the heme level in H9c2 cells with a different concentration of doxorubicin
As shown in Figure 1, compared with the control group (5088.4±153.1ng/ml), heme levels of H9c2 cells were significantly up-regulated to a 1.27-fold (6493.1±138.8 ng/ml), a 1.56-fold (7498.9±110.2ng/ml), and a maximum 2.34-fold (11896.6±187.3ng/ml) increase in 1μM, 2μM, and 5μM doxorubicin groups, separately (p<0.01). This up-regulation trend was dropped back to a 1.95-fold (9911.9±286.8ng/ml) increase in the 10μM doxorubicin group, as compared to the control group (p<0.01).
Effects of doxorubicin on heme levels in H9c2 cells exposed to saline (control group) or doxorubicin with different concentrations for 24 hours. Heme levels were measured by ELISA. Data are presented as the mean±standard deviation. *p<0.01, compared with the control group.
The Effects of doxorubicin on the apoptosis rate of H9c2 cells
The flow cytometry analysis showed that, compared with the control group treated with saline, the apoptosis rate of H9c2 cells treated with different concentrations of doxorubicin was significantly increased, as shown in Figure 2. When incubated with 1, 2, 5, and 10μM doxorubicin for 24h, the total apoptosis rate, including both early and end-stage apoptosis, of H9c2 was increased to 10.6±1.6%, 41.1±1.9%, 60.5±3.6%, and 76.0±2.5%, respectively, as compared to 2.1±0.5% in the control group (p<0.01).
– Flow cytometry analysis to evaluate the effects of doxorubicin on H9c2 cell viability. H9c2 cells were pretreated with saline (control) and doxorubicin at 1, 2, 5 and 10μM, respectively, for 24h. (A) Representative flow cytometry analyses of five individual experiments corresponding to control and different concentration doxorubicin treatment, respectively. (B) Statistical graph of annexin V-FITC/PI staining. Results was expressed as mean±SD. * p<0.01 vs control group.
Regulation of aminolaevulinic acid synthase 1 (ALAS1) and aminolaevulinic acid synthase 2 (ALAS2) messenger RNA (mRNA) expression in H9c2 cells after doxorubicin treatment
As the first step and rate-limiting enzymes for heme synthesis that occur in the mitochondria, the mRNA expression of ALAS1 and ALAS2 under doxorubicin treatment were evaluated. After incubating with 1μM and 2μM doxorubicin, the mRNA expressions of ALAS1 were down-regulated (though not statistically significant). After treating with 5μM and 10μM doxorubicin, the ALAS1 mRNA expressions were statistically increased to 41.1-fold and 375.3-fold, separately, as compared to the control group. Unlike ALAS1, ALAS2 mRNA expression proved to be progressively and significantly down-regulated (1μM group:0.88-fold, 2μM group: 0.83-fold, 5μM group: 0.49-fold, 10μM group:0.31-fold respectively, as shown in Figure 3A.)
– (A) mRNA expression changes of ALAS1 and ALAS2 under doxorubicin treatment. ALAS1, aminolaevulinic acid synthase 1; ALAS2, aminolaevulinic acid synthase 2. (B) Characteristics of mRNA expression changes for heme catabolic enzymes under doxorubicin treatment. HOX-1, heme oxygenase 1; HOX-2, heme oxygenase 2. * indicate p<0.01 vs. Control group.
Regulation of mRNA expression for HOX-1 and HOX-2 in H9c2 cells after doxorubicin treatment
The cytoplastic rate-limiting enzymes in heme catabolism, HOX-1 and HOX-2, were examined. It was found that after having been incubated with an increasing level of doxorubicin, the HOX-1 and HOX-2 mRNA exhibited the same regulation pattern, although with different changing levels. No significant change was observed in mRNA expression after 1μM and 2μM doxorubicin treatment, when compared with the control group, for either HOX-1 or HOX-2. After incubating with 5μM doxorubicin, the mRNA expression for HOX-1 and HOX-2 significantly up-regulated to 4.3-fold and 15.5-fold changes, respectively (p<0.01). But after treatment with 10μM doxorubicin, the up-regulation was declined to the extent of 2.6-fold and 3.2-fold, separately, when compared with the control group (p<0.01), as shown in Figure 3B.
Regulation of ALAS1, ALAS2, HOX-1, and HOX-2 protein levels after doxorubicin treatment
Western blot analysis showed that, identical to their mRNA expression pattern, ALAS1 protein levels were significantly down-regulated in the 2μM doxorubicin group and up-regulated in 10μM doxorubicin groups, when compared with the control group. ALAS2 protein levels were found to be progressively down-regulated as the doxorubicin concentration increased from 1μM to 10μM, as shown in Figure 4A.
– Analysis data of western blotting for ALAS (A) and HOX (B) protein level change in H9c2 cells at different concentrations for doxorubicin. ALAS1, aminolaevulinic acid synthase 1; ALAS2, aminolaevulinic acid synthase; HOX-1, heme oxygenase 1; HOX-2, heme oxygenase 2. Each western blot was conducted three times. * indicate p<0.01 vs. control group.
Protein expression of HOX-1 was slightly down-regulated under 1μM and 2μM doxorubicin treatment, and then sharply up-regulated when compared with the control group. However, inconsistent with the mRNA expression pattern, our study detected a progressive increase in the HOX-2 protein level, with an increase in the doxorubicin concentration from 1μM to 5μM, and then a decline to the baseline level when treated with 10μM doxorubicin (Figure 4B).
Discussion
Doxorubicin is a kind of anthracycline drug, which is an effective broad-spectrum anti-tumor drug. It is widely used in the treatment of various malignant tumors, such as breast cancer, lung cancer, and lymphoma.5 But the toxic cardiac effects of doxorubicin in a clinical chemotherapy dose is severe and dose-dependent, which can cause cardiomyopathy and congestive heart failure, and thus greatly limits its clinical use.6 Different from the mechanism of its anti-tumor activity, the primary mechanism of cardiac toxicity induced by doxorubicin, is the generation of iron-mediated reactive oxygen species (ROS) and the subsequent promotion of myocardial oxidative stress.7 Heme is an essential mediator of the biochemical availability of iron.8The function of the heme molecule varies according to the binding protein it coordinates with. It may serve as a mediator of oxygen transport and storage in hemoglobin9 or myoglobin,10 whereas it acts as an electron transporter in cytochromes and is the critical source of redox-active iro.11 Bhoite-Solomon et al. found that free heme is toxic to the myocardium and caused cytolysis through sarcolemma damage in a concentration-dependent manner.12 In addition to cardiomyocyte, free heme can also be toxic to human epithelial cells and neuron-like cells13,14 through oxidative stress caused by cell apoptosis or necrosis. Moreover, free heme can cause endothelial cell injury by stimulating the expression of inflammatory factors.15,16
However, unlike the abundant studies in the iron-mediated oxidative injury in cardiomyocyte treated with anthracycline drugs, the intracellular heme level variation and the regulation processes of its synthesis and metabolism have not been well evaluated in cardiomyocyte under anthracycline treatment. The present study systematically examined the variation characteristics of biosynthetic and degradative enzymes for heme for the first time.
In the heme biosynthesis pathway, there are eight enzymes involved, among which four are mitochondrial enzymes, and four are cytoplasmic enzymes.17 For the first step of heme synthesis, glycine and succinyl coenzyme A are condensed into δ-aminolevulinic acid (ALA). This reaction needs to be catalyzed by aminolevulinic acid synthase (ALAS).18 There are two types of ALAS: ALAS1 and ALAS2. The former has a universal expression, while the latter is dominantly expressed in red blood cell precursor cells.19 The present study found that not only ALAS1, but also ALAS2, were both expressed in the H9c2 cells at baseline levels. After the treatment with doxorubicin, ALAS1 and ALAS2 mRNA expression exhibit two distinct changing patterns. The ALAS1 mRNA and protein expression at first presented a trend of inhibition (though not statistically significant in our study) with 1μM and 2μM doxorubicin and then showed a dramatic up-regulation pattern with 5μM and 10μM doxorubicin treatment.
By contrast, mRNA and protein expression of ALAS2 were progressively suppressed to the lowest level when treated with 10μM doxorubicin, with 69.0% and 35.0% reductions, respectively. This phenomenon indicates that, under the effect of doxorubicin, the regulation of ALAS1 and ALAS2 may occur through the different pathways and seek different targeting bioprocesses. The step-down-regulation of ALAS2 can be explained by the negative feedback from a progressive elevation of heme level. This effect might be achieved by repressing ALAS2 mRNA transcription, as shown in our real-time PCR results, as well as by interrupting ALAS2 formation through a block of the ALAS2 precursor into mitochondria.20,21 In red blood cells, the expression of ALAS2 is determined by the trans-activation of nuclear factors GATA-1, CACC box, and NF-E2-binding sites in the promoter area, and its synthesis is regulated by the amount of free iron. 22 However, the regulation mechanism of ALAS2 in cardiomyocyte under doxorubicin treatment will need to be further researched.
In our study, ALAS1, which was supposed to be strictly under negative feedback control at a low level to prevent a high cytotoxic heme level, was overexpressed both in gene and protein aspects, despite the simultaneously existing high heme level. Podvinec et al.23 reported that drugs that induce cytochromes P450 and other drug-metabolizing related enzymes might simultaneously and transcriptionally up-regulate ALAS1 expression, which is the first step in the heme synthesis, to coordinate with the need of up-regulated cytochrome P450 activity. This process was mediated through two enhancer elements, located 20 and 16 kb upstream of the transcriptional start site of ALAS1, and their interaction with the xenoreceptors NR1I2 and NR1I3.23 Zordoky et al.24 revealed that doxorubicin caused a significant induction of several cytochrome P450 genes, such as CYP1A1, CYP1A2, CYP1B1, and CYP2B2 gene expression in a concentration-dependent manner. NR1I2 and NR1I3 have also been proved to be the crucial nuclear receptors mediating the interaction between doxorubicin and metabolizing enzymes.25 The precise mechanism for the regulation of ALAS expression patterns in the cardiomyocyte will need to be elucidated in future study.
Heme oxidase (HOX) is the rate-limiting enzyme in the process of heme degradation, which can oxidatively degrade the heme molecule to produce carbon monoxide, iron, and biliverdin. Heme oxidase has two isoenzymes, heme oxidase 1 (HOX-1) and heme oxidase 2 (HOX-2). HOX-2 mainly plays a regulatory role under normal physiological conditions, while HOX-2 may protect cells and tissues under oxidative stress.26
The HOX-1 expression may be promoted by a variety of stimuli including doxorubicin27 and intracellular accumulation of heme. Previous studies revealed that HO-1 expression is primarily regulated at the transcriptional level, several regulatory elements have been identified to play important roles in up-regulating HOX-1, including metal response elements (MREs), stress response elements (StREs), AP-1, and NF-B. 28 On the other hand, Bach1 has proven to have a repressor effect on HOX-1 expression.29The present study found HOX-1 in H9c2 cardiomyocytes was down-regulated in the first place when treated with low concentration doxorubicin (1μM and 2μM) in H9c2 cells and then significantly up-regulated with 5μM and 10μM doxorubicin incubation. Our research indicates that further studies focusing on the interaction between various regulators and HOX-1 gene elements under different doxorubicin concentration will be needed.
In spite of exhibiting a similar pattern of mRNA expression with HOX-1, the HOX-2 protein level was progressively elevated, along with the doxorubicin concentration, which increased from 1μM to 5μM and abruptly declined below the baseline level when treated with 10μM doxorubicin. The difference in the changing profile of the protein level between HOX-1 and HOX-2 may be due to the difference in their regulation mechanisms.30,31In rats, HOX-2 expression is modulated by glucocorticoids through the glucocorticoid responsive element (GRE).32 To the best of our knowledge, this is the first study on the effect of doxorubicin on HOX-2 expression in cardiomyocytes; however, the precise mechanism of action between doxorubicin and HOX-2 regulation remains a critical, unsolved question.
Study limitations
The lack of results in detecting enzyme activities in H9c2 cells was believed to be the main limitation of our study. Meanwhile, the oxidative stress level, according to the changes in heme metabolism, has not been explored, which may well elucidate the relationship between heme metabolic enzymes and doxorubicin-induced cardiotoxicity. Further studies covering these aspects are warranted to clarify the effect of doxorubicin on the heme biosynthesis and metabolism.
Conclusions
The increase in ALAS1 expression may play a potential role in the heme level elevation when H9c2 cardiomyocyte is exposed to doxorubicin. Although HOXs were upregulated under moderate-high concentration doxorubicin treatment, their degradative effects were overwhelmed by the uncontrolled heme synthesis activation. The specific mechanisms for the loss of negative feedback control to heme formation under doxorubicin treatment and the potential role of ALAS as a therapeutic target against the doxorubicin-induced heme cytotoxicity will need to be studied in future investigations.
Study Association
This study is not associated with any thesis or dissertation work.
Ethics approval and consent to participate
This article does not contain any studies with human participants or animals performed by any of the authors.
Sources of Funding.This study was funded by Beijing Municipal Natural Science Foundation (Grant nº 7162089).