Arq Bras CardiolabcArquivos Brasileiros de CardiologiaArq. Bras. Cardiol.0066-782X1678-4170Sociedade Brasileira de Cardiologia - SBCYDSVCVtMy6h54wYZq7ZFvTmS0066-782X2019000200154S0066-782X201800501910410.5935/abc.20190002Original ArticleThe Effect of Garlic and Voluntary Exercise on Cardiac Angiogenesis in Diabetes: The Role of MiR-126 and MiR-210NaderiRoya12MohaddesGisou3MohammadiMustafa4AlihemmatiAlireza5KhamanehAmirmahdi6GhyasiRafighe4GhaznaviRana7Urmia University of Medical SciencesNephrology and Kidney Transplant Research CenterUrmiaIranNephrology and Kidney Transplant Research Center - Urmia University of Medical Sciences, Urmia - IranUrmia University of Medical Sciencesfaculty of MedicineDepartment of PhysiologyUrmiaIranDepartment of Physiology, faculty of Medicine - Urmia University of Medical Sciences, Urmia - IranUniversity of Medical SciencesNeuroscience Research Centre of TabrizTabrizIranNeuroscience Research Centre of Tabriz University of Medical Sciences, Tabriz - IranUniversity of Medical SciencesDrug Applied Research Center of TabrizTabrizIranDrug Applied Research Center of Tabriz University of Medical Sciences, Tabriz - IranTabriz University of Medical SciencesFaculty of MedicineDepartment of Histology and EmbryologyIranDepartment of Histology and Embryology, Faculty of Medicine, Tabriz University of Medical Sciences, Tabriz - IranTabriz University of Medical SciencesSchool of advanced medical sciencesTabrizIranSchool of advanced medical sciences - Tabriz University of Medical Sciences, Tabriz - IranTehran University of Medical SciencesNeuroscience instituteSports medicine research centerTehranIranSports medicine research center, Neuroscience institute - Tehran University of Medical Sciences, Tehran - IranCorrespondência: Mustafa Mohammadi, Drug Applied Research Center of Tabriz University of Medical Sciences, Tabriz -Iran. E-mail: m.mohammadin@yahoo.com
Author contributions
Conception and design of the research, analysis and interpretation of the data and statistical analysis: Naderi R, Mohaddes G, Mohammadi M; acquisition of data: Naderi R, Ghaznavi R, Ghyasi R; obtaining funding, writing of the manuscript and critical revision of the manuscript for intellectual contente: Naderi R; Histological finding and interpretation of the data: Alihemmati A; Contribue to real time PCR protocol: Khamaneh A.
Potential Conflict of Interest
No potential conflict of interest relevant to this article was reported.
171220180220191122154162050220180208201802082018This is an Open Access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly citedAbstractBackground:
Diabetes mellitus (DM) is one of the major risk factors for cardiovascular disease, leading to endothelial dysfunction and angiogenesis impairment . MiR-126 and miR-210 support angiogenic response in endothelial cells.
Objective:
The present study sought to explore the effect of garlic and voluntary exercise, alone or together, on miR-126 and miR-210 expressions and cardiac angiogenesis in rats with type 1 diabetes.
Methods:
Male Wistar rats were divided into five groups (n = 7): Control, Diabetes, Diabetes+Garlic, Diabetes+Exercise, and Diabetes+Garlic+Exercise. Diabetes was induced in the animals by streptozotocin (ip, 50 mg/kg). The rats were then fed raw fresh garlic homogenate (250 mg/kg) or were subjected to voluntary exercise, or to combined garlic and voluntary exercise for 6 weeks. MiR-126 and miR-210 expressions in the myocardium were determined by real time PCR, and the serum lipid profile was measured by enzymatic kits. Angiogenesis was evaluated by immunostaining for PECAM-1/ CD31 in the myocardium.
Results:
Diabetes reduced both cardiac miR-126 expression and angiogenesis (p < 0.05). On the other hand, there was a miR-210 expression increase in the myocardium of diabetic animals (p < 0.001). However, those effects reversed either with garlic or voluntary exercise (p < 0.01). Moreover, treating diabetic rats with garlic and voluntary exercise combined had an additional effect on the expressions of miR-126 and miR-210 (p < 0.001). Furthermore, both voluntary exercise and garlic significantly improved serum lipid profiles (p < 0.001).
Conclusion:
The induction of diabetes decreased angiogenesis in the myocardium, whereas our treatment using long-term voluntary exercise and garlic improved myocardial angiogenesis. These changes were possibly owing to the enhancement of myocardial miR-126 and miR-210 expressions.
Diabetes mellitus (DM) is one of the major risk factors for cardiovascular disease, leading to endothelial dysfunction and angiogenesis impairment.1 The current trend on research and health care focuses on providing effective therapy with few side effects and low toxicity that can be regularly used to control diabetes complications.2
Exercise is a powerful therapeutic strategy to improve overall cardiovascular health.3 However, exhaustive exercise may be problematic as it can cause the production of reactive oxygen species (ROS).4 Therefore, voluntary exercise, in which the animal has free access to a running wheel, may be a model with more positive effects.5 There is evidence that aerobic training can promote cardiac angiogenesis,6,7 in which the vascular endothelial growth factor (VEGF) has a critical role.5 However, the underlying mechanisms of exercise have yet to be fully elucidated.
One of the most traditional plants in herbal medicine is Allium sativum L, which has been reported to have beneficial health effects. It is used as a therapeutic agent in various disorders such as cancer, cardiovascular disease, and diabetes through different mechanisms, including inhibition or stimulation of angiogenesis.2,8,9 Considering the effects of garlic in protecting against cardiovascular disease, as well as its effects on angiogenesis in different tissues, it is interesting to examine the effects of garlic on both myocardial angiogenesis and its related mechanisms.
MiRs are small non-coding RNAs that function in RNA silencing and the post-transcriptional regulation of gene expression.10 MiRs are essential intracellular mediators in many processes such as inflammation, mitochondrial metabolism, apoptosis, and angiogenesis, which can be adjusted through exercise.11 Therefore, miRs can be clinically useful in the treatment of several disorders. Moreover, miRs are released in urine and in the bloodstream following tissue injury, which makes them useful biomarkers for early detection, diagnosis, and prognosis of disorders. Recently, these molecules have been found to be involved in cardiovascular diseases.12 This includes a high expression of miR-126 in the heart endothelium, as well as its involvement in angiogenesis.12,13 Circulating levels of miR-126 are reduced in diabetes,14,15 suggesting that its deficiency may impair vascularisation.16 Moreover, Fasanaro et al.17 reported that hypoxia-driven miR-210 supports angiogenic response in endothelial cells and that its blockade by anti-miR transfection inhibits the formation of capillary-like structures.17
Many diabetes complications are well-known to be associated with lipid disorders. Indeed, dyslipidemia impairs numerous organs and is recognized as an important factor of many diabetic complications, including vascular abnormalities.18
Therefore, the aim of this study was to investigate the effect of voluntary exercise and garlic treatment alone or in combination on miR-126 and miR-210 expressions, serum lipid profile, as well as their relationship with cardiac angiogenesis in diabetes.
MethodsAnimals and Experimental Design
The Ethics Committee for Animal Experiments approved the study plan, and all experiments were conducted in accordance with the National Institute of Health’s Guide for the Care and Use of Laboratory Animals. Male Wistar rats (200-250 g) were provided by our university’s colony. All animals were housed in a temperature-controlled facility (21-23°C) maintained on a 12:12-h light-dark cycle, with food and water provided ad libitum.
In this study, thirty-five male rats were divided into five groups (n = 7): Control, Diabetes, Diabetes+Garlic, Diabetes+Exercise, and Diabetes+Garlic+Exercise. Control animals received 0.4 mL of sodium citrate buffer, pH 4.5. Diabetes was induced using a single intraperitoneal dose (50 mg/kg) of Streptozotocin (Sigma, St. Louis, Mo, USA). Blood glucose level was measured 72 hours later using a glucometer (Elegance, Model: no: CT-X10 Germany), and induced diabetes was identified if blood glucose level was > 300 mg/dL (16.67 mmol/L).
In this study, sample size was determined based on our similar previous studies.8,19
Voluntary exercise
Rats in the voluntary exercise groups were housed individually in cages with stainless-steel running wheels (1.00 m circumference, TajhizGostar) and were allowed free access to the wheel 24 h per day for 6 weeks. Running distance was monitored daily. If the running distance was below 2000 m/day, that animal was excluded from the study. Sedentary rats were housed in standard holding cages without running wheels for the same period.
Preparing Garlic Homogenate
Garlic (Allium sativum) bulbs were purchased from a local market. Cloves were peeled, sliced, ground into a paste and then dissolved in distilled water. The garlic homogenate was freshly prepared each day.
Sampling
At the end of the 6th week, the rats were deeply anesthetized with pentobarbital sodium (35 mg/kg, i.p.), blood samples were collected from the inferior vena cava to measure lipid profile.
Then the heart was quickly removed through midsternal thoracotomy and the left ventricle was excised, frozen in liquid nitrogen, and stored at deep freeze (-70°C) for later measurements. The myocardium was used for miR extraction, real-time PCR study and angiogenesis determination.
MiR Extraction and Real-Time PCR
MiR was extracted from the myocardium using miRCURYTMRNA isolation kit (Exiqon, Vedbaek, Denmark) according to the manufacturer’s protocol.20,21 The procedure was performed based on the spin column using a proprietary resin as a matrix to separate RNA from other cell components. RNA content and purity were measured using the Nanodrop 1000 spectrophotometer (Thermo scientific, Wilmington, DE 19810 USA). MiR-126 expression profile was obtained for total RNA extracts using universal a cDNA synthesis kit. Briefly, total RNA containing microRNA was polyadenylated and cDNA was synthesized using a poly(T) primer with a 3’ degenerate anchor and a 5’ universal tag (Exiqon, Vedbaek, Denmark). Each cDNA was used as a template for microRNA quantitative real-time PCR by using the SYBR Green master mix (Exiqon, Vedbaek, Denmark). LNA (Locked Nucleic Acid) forward and reverse primer sets (Exiqon, Vedbaek, Denmark) for microRNA are listed in Table 1. Real-time PCR reactions were performed with a Bio-Rad iQ5 detection System (Bio-Rad, Richmond, CA, USA). The amount of PCR products was normalized with housekeeping rno-miR-191 for miR-126 and miR-210.37 We used the 2-(ΔΔCt) method to determine the relative quantitative levels of miR-126 and miR-210. Results were expressed as the fold-difference to the relevant controls.
Target sequence list for miRs
Gene name
Accession number
Target sequence*
rno-miR-191
MIMAT0000440
CAACGGAAUCCCAAAAGCAGCUG
hsa-miR-126
MIMAT0002957
UCGUACCGUGAGUAAUAAUGC
dme-miR- 210
MIMAT0001233
UUGUGCGUGUGACAGCGGCUA
Sequences were derived from miRBase (www.mirbase.org).
Immunostaining for PECAM-1/ CD31
To investigate angiogenesis in the myocardium, transversal sections of the ventricles at their midportion were immediately isolated and fixed in 10% buffered-formalin solution, dehydrated in ascending grades of alcohol and embedded in paraffin. Then, serial 3 µm-thick sections were cut from them and floated onto charged glass slides according to standard histological processing. Tissue pieces were deparaffinised in xylene and dehydrated in a graded series of ethanol. Slides were incubated sequentially in proteinase K and 0.3% hydrogen peroxide to block endogenous peroxidase activity. Sections were overlaid by primary antibody CD31 (Santa Cruz, USA) - an angiogenesis marker - and incubated at +4°C overnight. Afterwards, the sections were washed and incubated with standard avidin-biotin complex (ABC; Santa Cruz) according to the protocol. Then the slides were incubated in DAB (Diamino-benzidine, Santa Cruz) as the chromagen, and counterstained with Mayer's hematoxylin. Finally, the sections were cleared in xylene, mounted with Entellan and analyzed with a light microscope.
Assessment of immunostaining
To evaluate immunostaining, 3 to 5 sections of 1 mm2 were randomly selected at a magnification of 400×, depending on the size of the sample section. Both staining intensity and number of positive cells were evaluated semi-quantitatively. Intensity scoring for CD31 staining was obtained within each area at a 400× magnification. Each endothelial cell cluster of immunoreactivity expressing CD31 and forming lumen or vessels was counted as individual microvessels. Vascular structures positive for CD31 were counted for 5 to 6 slides per animal and 10 fields per slide.
To assess immunostaining, we used the granulation tissue as a positive control, and the intensity of the staining was scored as follows: 0 (<10%); 1 (10% to 25%); 2 (25% to 50%); 3 (50% to 75%) or 4 (75% to 100%).22
Lipid profile measurement
Blood samples were obtained from the inferior vena cava, then centrifuged at 3500 rpm for 10 min at 4°C, and serum was collected. Triglycerides serum level was determined by enzymatic kits (ZiestChem Diagnostic kits, Iran) using glycerol as the standard. Additionally, high-density lipoprotein (HDL) and low-density lipoprotein (LDL) levels were determined based on enzymatic methods by diagnostic kits, (ZiestChem, Iran) using cholesterol as the standard.
Statistical analysis
All results are expressed as mean ± SEM for seven animals, and analyses were performed using SPSS statistical software version 16. All parameters were tested for normality using the theone-sample Kolmogorov-Smirnov test. Data were statistically analyzed using one-way analysis of variance (ANOVA) followed by Tukey’s test. The significant level was set at p < 0.05.
ResultsEffects of garlic and voluntary exercise on miR-126 in the myocardium
As shown in Figure 1, myocardial miR-126 expression level was significantly lower (p < 0.05) in rats with diabetes than in the control group. Treatment with garlic (p < 0.001), voluntary exercise (p < 0.01), or both combined increased significantly (p < 0.001) the myocardial miR-126 expression in diabetic rats compared to the diabetes group. Moreover, the Diabetes+Garlic+Exercise group had significantly higher level of miR-126 expression compared to the garlic treatment group (p < 0.05) and the just voluntary exercise group (p < 0.01) in diabetic animals.
Real-time quantitative PCR analysis of miR-126 in the heart tissue of experimental groups. The values represent means ± S.E.M for 7 animals. *p < 0.05 vs control group, <sup>$$</sup>p < 0.01 and<sup>$$$</sup> p < 0.001 vs diabetes group, <sup>&&</sup> p < 0.01 vs Diabetes+Exercise group, and <sup>#</sup>p < 0.05 vs Diabetes+Garlic group.
Effects of garlic and voluntary exercise on miR-210 in the myocardium
As shown in Figure 2, the expression of miR-210 significantly increased (p < 0.001) in animals with diabetes compared with the control group. Treatment with garlic (p < 0.01), voluntary exercise (p < 0.01), or both combined reduced significantly (p < 0.001) the myocardial miR-210 expression in diabetic rats compared to the diabetes group. The combined Garlic+Voluntary Exercise group significantly lowered miR-210 expression compared to the Diabetes+Exercise (p < 0.05) and Diabetes+Garlic (p < 0.01) groups
Real-time quantitative PCR analysis of miR-210 in the heart tissue of experimental groups. The values represent means ± S.E.M for 7 animals. ***p < 0.001 vs control group, <sup>$$</sup>p < 0.01 and <sup>$$$</sup>p < 0.001 vs diabetes group, <sup>&</sup>p < 0.05 vs Diabetes + Exercise group, and <sup>##</sup>p < 0.01 vs Diabetes + Garlic group.
Effect of garlic and voluntary exercise on angiogenesis in the myocardium
Immunostaining with CD31 marker was performed for the assessment of angiogenesis in the transversal section of the ventricles at their midportion. Brown stained tissues show CD-31 immunostained endothelial cells. Figure 4 shows the scores for staining intensity, which are as follows: 0 (<10%); 1 (10% to 25%); 2 (25% to 50%); 3 (50% to 75%) or 4 (75% to 100%). As shown in Figures 3 and 4, statistical analysis of our immunohistochemical study revealed that angiogenesis decreased significantly (p < 0.01) in the diabetes group compared to the control group. Six weeks of garlic treatment, voluntary exercise, or a combination thereof in the diabetes groups increased significantly (p < 0.001) the angiogenesis in their left ventricle compared to the diabetes group (Figure 3 and 4). Combined garlic consumption and exercise in diabetic animals induced more angiogenesis compared to garlic alone and exercise alone, though the difference was not significant.
Immunohistochemical detection of CD31 in myocardial vessels of different groups. Brown stained tissues show CD-31 immunostained endothelial cells in: (A) Control; (B) Diabetes; (C) Diabetes+Garlic; (D) Diabetes+Exercise; and (E) Diabetes+Garlic+Exercise. The intensity of immunostaining for CD31 (arrow head) decreased in the diabetes group compared to the control group. Garlic treatment and exercise alone or combined increased angiogenesis in diabetes compared to the diabetes group (Magnification was 400x).
Effects of garlic treatment and voluntary exercise on angiogenesis in different experimental groups. The intensity of the staining was scored as: 0 (<10%); 1 (10-25%); 2 (25-50%); 3 (50-75%); and 4 (75-100%). The values represent means ± S.E.M for 7 animals. **p < 0.01 vs control group and <sup>$$$</sup>p < 0.001 vs diabetes group.
Effect of garlic and voluntary exercise on serum lipid profile
Lipid profile alterations in different groups are shown in Table 2. The induction of diabetes in the animals increased significantly (p < 0.001) the serum TGs and LDL levels while lowering serum HDL and HDL/LDL compared to the control animals. Voluntary exercise reduced significantly (p < 0.05) the serum triglycerides levels in the diabetes group compared with the control group. Six weeks of garlic treatment alone or with voluntary exercise decreased significantly (p < 0.01) the triglycerides levels in the animals with diabetes. In these, serum LDL levels decreased significantly (p < 0.001) after garlic alone and exercise alone or a combination thereof. However, serum HDL level was significantly increased (p < 0.001) by garlic treatment, voluntary exercise, or a combination thereof in diabetic rats. Furthermore, the HDL:LDL ratio was significantly higher (p < 0.001) in the Diabetes+Garlic, Diabetes+Exercise and Diabetes+Garlic+Exercise groups compared with diabetes group.
Serum lipid profile in different groups after 6 weeks (Mean ± SEM, n = 7)
Variants
Control
Diabetes
Diabetes+ Garlic
Diabetes+ Exercise
Diabetes+Garlic +Exercise
Triglyceride (mg/dl)
21.3 ± 2.9
87.8 ± 14.3***
42 ± 2.9$$
50.1 ± 9.3$
44.8 ± 3.7$$
LDL(mg/dl)
41 ± 1.69
48.87 ± 1.21***
38.66 ± 0.61$$$
39 ± 0.81$$$
38.33 ± 0.76$$$
HDL(mg/dl)
28.8 ± 1.07
18.25 ± 0.83***
28.16 ± 1.22$$$
26.66 ± 1.47$$$
27 ± 1.46$$$
HDL/LDL
0.7 ± 0.03
0.36 ± 0.01***
0.72 ± 0.03$$$
0.67 ± 0.03$$$
0.7 ± 0.04$$$
p < 0.001 vs control group and
p < 0.001 vs diabetes group. Triglycerides (TG), High-density lipoprotein (HDL), Low-density lipoprotein (LDL)
Discussion
The present study has shown that the induction of diabetes impaired serum lipid profile, decreased myocardial angiogenesis and miR-126 expression, and increased myocardial expression of miR-210. However, the treatment with garlic alone, voluntary exercise alone or both combined ameliorated these effects in the myocardium of diabetic animals. Interestingly, treating diabetic rats simultaneously with garlic and voluntary exercise had an additional effect on the cardiac expression of miR-126 and miR-210. In line with our study, research has shown that diabetes leads to an impaired function of early endothelial progenitor cells, which results in a reduced capacity of neovascularisation and angiogenesis in the myocardium of diabetic rats.23 VEGF, as an inducer of angiogenesis, is a highly specific mitogen for endothelial cells.24 It is well-known that the expression of VEGF-A and its receptors decreases in the myocardium of diabetic rats and humans.25 However, the actual process of VEGF and angiogenesis reduction in the diabetic heart has not been fully elucidated.
There is a variety of miRs in the heart tissue, and these tiny regulators are recognized as novel targets/drugs in numerous fields, including cardiology.12 MiR-126 is known as an endothelial-specific miR that modulates angiogenesis in vivo. Several studies have shown miR-126 to support endothelial homeostasis and angiogenesis,12,13,15 which is mediated by SPRED1 and PIK3R2 to promote VEGF signaling.15 In addition, miR-126 activates survival kinases such as ERK and Akt by downregulating its targets and promoting the action of VEGF.26 Osipova et al reported in their study that urinary miR-126 levels were reduced in the patients with diabetes; however, circulating miR-126 levels in plasma showed no significant difference.1
Little information is available about the expression of miR in the myocardium of diabetic rats in response to voluntary exercise. Interestingly, in the present study, we observed that garlic, voluntary exercise and a combination thereof increased the levels of miR-126 expression and angiogenesis in the myocardium. Cardioprotective effects of garlic have been reported in some studies related to improvement of antioxidant activities,8 AMPK-mediated AKT/GSK-3β/HIF-1α activation,27 and Akt-eNOS signaling pathways.28 Moreover, in line with our results, da Silva et al.6 showed that aerobic training in healthy rats increased cardiac miR-126 expression, which was possibly related to exercise-induced cardiac angiogenesis.6 Furthermore, studies have demonstrated that exercise enhances angiogenesis in the heart both under healthy29 and pathological conditions,5,7 which highlights the positive effect of physical activity as a non-pharmacological tool in the treatment of cardiovascular disorders. Considering the increased expression of miR-126 following voluntary exercise, cardiac angiogenesis is possibly related to exercise-induced miR-126 expression and VEGF modulation, which upregulates angiogenic pathways such as MAPK and PI3K/Akt/eNOS.6
An important hypoxia-induced miR, miR-210 is stimulated following hypoxia and HIF activation.30 The elevation of miR-210 gene expression is evidence of hypoxic conditions in the cardiac muscle, in which hypoxia stimulates a number of physiological responses such as angiogenesis through HIF-1α-induced miR-210 expression.31 MiR-210 upregulation is a major element of endothelial cell response to hypoxia, which leads to angiogenesis via its target gene Ephrin-A3.17 The upregulation of miR-210 and VEGF has been shown to enhance myocardium angiogenesis in acute myocardial infarction in response to Huoxue Anxin Recipe.32 Greco et al.33 described that, in addition to hypoxia, hyperglycemia is another stimulator that upregulates miR-210 expression, which is observed in diabetes.33 Osipova et al.1 showed that miR-210 level was upregulated in plasma and urine of type 1 diabetic children,1 as well as in cardiomyocytes and endothelial cells in diabetic patients.33 In line with these studies, we showed that the induction of diabetes increased myocardial miR-210 level, which was reduced by both garlic, voluntary exercise and a combination of both. Similarly, a recent study demonstrated that plasma miR-210 levels decreased in chronic kidney disease after acute exercise.34 On the contrary, some studies have shown that miR-210 was not responsive during acute, exhaustive exercise, sustained aerobic exercise11 and swimming35 in the heart tissue. Furthermore, both garlic and exercise have been shown to be involved in providing good glycemic control and prevention against long-term diabetic complications.3,8,19 Therefore, in the present study, the decrease of miR-210 expression back to normal levels seems to stem from glycemic control. Additionally, garlic extract-mediated angiogenesis probably occurs through the upregulation of the neovasculogenic c-kit protein expression and the activation of the PI3-K/Akt/NF-κB signaling pathways,36 which regulates e-NOS activation and NO production.11
Hyperglycemia is currently considered to be primarily responsible for the alteration of lipid profile. In general, dyslipidemia is well confirmed in diabetes mellitus; it is known as a criterion for the diagnosis of type I diabetes and potential beta-cell lipotoxin.37 It is worth noting that dyslipidemia is related to atherosclerosis and a risk of heart disease.37 Dyslipidemia is possibly mediated by the alteration of LXRα expression in the liver and intestine, the activation of nicotinamide adenine dinucleotide phosphate (NADPH) oxidase pathways, and the consequent inhibition of eNOS activity, causing impaired angiogenesis.15,38 In addition, dyslipidemia is related to decreased levels of circulating miR-126.13 Riedel et al.39 showed that exercise in patients with chronic heart failure significantly improved HDL-induced miR-126 expression.39 In this study, treatment with garlic and voluntary exercise alone and together ameliorated lipid profile in the serum of diabetic rats, which is in agreement with previous studies.6,9,40 Therefore, garlic and exercise have possibly modulated angiogenesis in the myocardium of the diabetic animals by modulating serum lipid profile and the expression of pro-angiogenic miRs. With regard to the limitations of this study, we did not measure other factors involved in angiogenesis. Further studies are necessary to clarify the pathophysiological mechanisms of garlic and voluntary exercise in the treatment of diabetic complications.
Conclusion
This study showed that garlic and voluntary exercise modulated serum lipid profile and the expression of miR-126, miR-210, thus increasing angiogenesis in myocardium of diabetic rats. These findings suggest that garlic and voluntary exercise alone and combined may hold benefits in the treatment of diabetes.
Sources of Funding
This study was funded by a grant from Drug Applied Research Center, Tabriz University of Medical Sciences.
Study Association
This article is part of the thesis of Doctoral submitted by Roya Naderi, from Drug Applied Research Center, Tabriz University of Medical Sciences.
Ethics approval and consent to participate
This study was approved by the Ethics Committee on Animal Experiments of the Tabriz University of Medical Sciences under the protocol number 91.4-2.4.
References1 Osipova J, Fischer D-C, Dangwal S, Volkmann I, Widera C, Schwarz K, et al. Diabetes-associated microRNAs in pediatric patients with type 1 diabetes mellitus: a cross-sectional cohort study. J Clin Endocrinol Metab. 2014;99(9):E1661-5.OsipovaJFischerD-CDangwalSVolkmannIWideraCSchwarzKDiabetes-associated microRNAs in pediatric patients with type 1 diabetes mellitus a cross-sectional cohort studyJ Clin Endocrinol Metab2014999E1661E16652 Tag H, Kalita P, Dwivedi P, Das AK, Namsa ND. Herbal medicines used in the treatment of diabetes mellitus in Arunachal Himalaya, northeast, India. J Ethnopharmacol. 2012;141(3):786-95.TagHKalitaPDwivediPDasAKNamsaNDHerbal medicines used in the treatment of diabetes mellitus in Arunachal Himalaya, northeast, IndiaJ Ethnopharmacol201214137867953 Chipkin SR, Klugh SA, Chasan-Taber L. Exercise and diabetes. Cardiol Clin. 2001;19(3):489-505.ChipkinSRKlughSAChasan-TaberLExercise and diabetesCardiol Clin20011934895054 Huang KC, Wu WT, Yang FL, Chiu YH, Peng TC, Hsu BG, et al. Effects of freshwater clam extract supplementation on time to exhaustion, muscle damage, pro/anti-inflammatory cytokines, and liver injury in rats after exhaustive exercise. Molecules. 2013;18(4):3825-38.HuangKCWuWTYangFLChiuYHPengTCHsuBGEffects of freshwater clam extract supplementation on time to exhaustion, muscle damage, pro/anti-inflammatory cytokines, and liver injury in rats after exhaustive exerciseMolecules2013184382538385 Wu G, Rana JS, Wykrzykowska J, Du Z, Ke Q, Kang P, et al. Exercise-induced expression of VEGF and salvation of myocardium in the early stage of myocardial infarction. Am J Physiol Heart Circ Physiol. 2009;296(2):H389-H95.WuGRanaJSWykrzykowskaJDuZKeQKangPExercise-induced expression of VEGF and salvation of myocardium in the early stage of myocardial infarctionAm J Physiol Heart Circ Physiol20092962H389HH956 Da Silva ND Jr, Fernandes T, Soci UP, Monteiro AW, Phillips MI, DE Oliveira EM. Swimming training in rats increases cardiac MicroRNA-126 expression and angiogenesis. Med Sci Sports Exerc. 2012;44(8):1453-62.Da Silva ND Jr.Fernandes T.Soci UP.Monteiro AW.Phillips MI.DE Oliveira EMSwimming training in rats increases cardiac MicroRNA-126 expression and angiogenesisMed Sci Sports Exerc2012448145314627 Leosco D, Rengo G, Iaccarino G, Golino L, Marchese M, Fortunato F, et al. Exercise promotes angiogenesis and improves beta-adrenergic receptor signalling in the post-ischaemic failing rat heart. Cardiovasc Res. 2008;78(2):385-94.LeoscoDRengoGIaccarinoGGolinoLMarcheseMFortunatoFExercise promotes angiogenesis and improves beta-adrenergic receptor signalling in the post-ischaemic failing rat heartCardiovasc Res20087823853948 Naderi R, Mohaddes G, Mohammadi M, Alihemmati A, Badalzadeh R, Ghaznavi R, et al. Preventive effects of garlic (Allium sativum) on oxidative stress and histopathology of cardiac tissue in streptozotocin-induced diabetic rats. Acta Physiol Hung. 2015;102(4):380-90.NaderiRMohaddesGMohammadiMAlihemmatiABadalzadehRGhaznaviRPreventive effects of garlic (Allium sativum) on oxidative stress and histopathology of cardiac tissue in streptozotocin-induced diabetic ratsActa Physiol Hung201510243803909 Bayan L, Koulivand PH, Gorji A. Garlic: a review of potential therapeutic effects. Avicenna J Phytomed. 2014;4(1):1-14.BayanLKoulivandPHGorjiAGarlic a review of potential therapeutic effectsAvicenna J Phytomed20144111410 Yin K-J, Hamblin M, Chen YE. Angiogenesis-regulating microRNAs and ischemic stroke. Curr Vasc Pharmacol. 2015;13(3):352-65.YinK-JHamblinMChenYEAngiogenesis-regulating microRNAs and ischemic strokeCurr Vasc Pharmacol201513335236511 Baggish AL, Hale A, Weiner RB, Lewis GD, Systrom D, Wang F, et al. Dynamic regulation of circulating microRNA during acute exhaustive exercise and sustained aerobic exercise training. J Physiol. 2011;589(Pt 16):3983-94.BaggishALHaleAWeinerRBLewisGDSystromDWangFDynamic regulation of circulating microRNA during acute exhaustive exercise and sustained aerobic exercise trainingJ Physiol2011589163983399412 Wang S, Aurora AB, Johnson BA, Qi X, McAnally J, Hill JA, et al. The endothelial-specific microRNA miR-126 governs vascular integrity and angiogenesis. Dev Cell. 2008;15(2):261-71.WangSAuroraABJohnsonBAQiXMcAnallyJHillJAThe endothelial-specific microRNA miR-126 governs vascular integrity and angiogenesisDev Cell200815226127113 Fish JE, Santoro MM, Morton SU, Yu S, Yeh RF, Wythe JD, et al. miR-126 regulates angiogenic signaling and vascular integrity. Dev Cell. 2008;15(2):272-84.FishJESantoroMMMortonSUYuSYehRFWytheJDet al miR-126 regulates angiogenic signaling and vascular integrityDevCell200815227228414 de Boer HC, van Solingen C, Prins J, Duijs JM, Huisman MV, Rabelink TJ, et al. Aspirin treatment hampers the use of plasma microRNA-126 as a biomarker for the progression of vascular disease. Eur Heart J. 2013;34(44):3451-7.de BoerHCvan SolingenCPrinsJDuijsJMHuismanMVRabelinkTJAspirin treatment hampers the use of plasma microRNA-126 as a biomarker for the progression of vascular diseaseEur Heart J201334443451345715 Liu Y, Gao G, Yang C, Zhou K, Shen B, Liang H, et al. The role of circulating microRNA-126 (miR-126): a novel biomarker for screening prediabetes and newly diagnosed type 2 diabetes mellitus. Int J Mol Sci. 2014;15(6):10567-77.LiuYGaoGYangCZhouKShenBLiangHThe role of circulating microRNA-126 (miR-126) a novel biomarker for screening prediabetes and newly diagnosed type 2 diabetes mellitusInt J Mol Sci2014156105671057716 Breen EC, Johnson EC, Wagner H, Tseng HM, Sung LA, Wagner PD. Angiogenic growth factor mRNA responses in muscle to a single bout of exercise. J Appl Physiol. 1996;81(1):355-61.BreenECJohnsonECWagnerHTsengHMSungLAWagnerPDAngiogenic growth factor mRNA responses in muscle to a single bout of exerciseJ Appl Physiol199681135536117 Fasanaro P, D'Alessandra Y, Di Stefano V, Melchionna R, Romani S, Pompilio G, et al. MicroRNA-210 modulates endothelial cell response to hypoxia and inhibits the receptor tyrosine kinase ligand Ephrin-A3. J Biol Chem. 2008;283(23):15878-83.FasanaroPD'Alessandra Y.Di Stefano V.Melchionna R.Romani S.Pompilio GMicroRNA-210 modulates endothelial cell response to hypoxia and inhibits the receptor tyrosine kinase ligand Ephrin-A3J Biol Chem200828323158781588318 de Amorim Miranda PH, Monteiro OM, Rossoni JV Jr., Silva ME, de Lima WG, Costa DC. Vildagliptin induces ß-cell neogenesis and improves the lipid profile in a later phase of type 1 diabetes. Curr Pharm Biotechnol. 2015;16(1):60-5.de Amorim Miranda PH.Monteiro OM.Rossoni JV Jr.Silva ME.de Lima WG.Costa DCVildagliptin induces ß-cell neogenesis and improves the lipid profile in a later phase of type 1 diabetesCurr Pharm Biotechnol2015161606519 Naderi R, Mohaddes G, Mohammadi M, Ghaznavi R, Ghyasi R, Vatankhah AM. Voluntary exercise protects heart from oxidative stress in diabetic rats. Adv Pharm Bull. 2015;5(2):231-6.NaderiRMohaddesGMohammadiMGhaznaviRGhyasiRVatankhahAMVoluntary exercise protects heart from oxidative stress in diabetic ratsAdv Pharm Bull20155223123620 Biyashev D, Veliceasa D, Topczewski J, Topczewska JM, Mizgirev I, Vinokour E, et al. miR-27b controls venous specification and tip cell fate. Blood. 2012;119(11):2679-87.BiyashevDVeliceasaDTopczewskiJTopczewskaJMMizgirevIVinokourEmiR-27b controls venous specification and tip cell fateBlood2012119112679268721 Lässer C, Eldh M, Lötvall J. Isolation and characterization of RNA-containing exosomes. J Vis Exp. 2012(59):e3037.LässerCEldhMLötvallJ.Isolation and characterization of RNA-containing exosomesJ Vis Exp201259e303722 Mirzaei Bavil F, Alipour MR, Keyhanmanesh R, Alihemmati A, Ghiyasi R, Mohaddes G. Ghrelin decreases angiogenesis, HIF-1a and VEGF protein levels in chronic hypoxia in lung tissue of male rats. Adv Pharm Bull. 2015;5(3):315-20.Mirzaei BavilFAlipourMRKeyhanmaneshRAlihemmatiAGhiyasiRMohaddesGGhrelin decreases angiogenesis, HIF-1a and VEGF protein levels in chronic hypoxia in lung tissue of male ratsAdv Pharm Bull20155331532023 Khazaei M, Fallahzadeh AR, Sharifi MR, Afsharmoghaddam N, Javanmard SH, Salehi E. Effects of diabetes on myocardial capillary density and serum angiogenesis biomarkers in male rats. Clinics. 2011;66(8):1419-24.KhazaeiMFallahzadehARSharifiMRAfsharmoghaddamNJavanmardSHSalehiEEffects of diabetes on myocardial capillary density and serum angiogenesis biomarkers in male ratsClinics20116681419142424 Hoeben A, Landuyt B, Highley MS, Wildiers H, Van Oosterom AT, De Bruijn EA. Vascular endothelial growth factor and angiogenesis. Pharmacol Rev. 2004;56(4):549-80.HoebenALanduytBHighleyMSWildiersHVan OosteromATDe BruijnEAVascular endothelial growth factor and angiogenesisPharmacol Rev200456454958025 Chou E, Suzuma I, Way KJ, Opland D, Clermont AC, Naruse K, et al. Decreased cardiac expression of vascular endothelial growth factor and its receptors in insulin-resistant and diabetic states: a possible explanation for impaired collateral formation in cardiac tissue. Circulation. 2002;105(3):373-9.ChouESuzumaIWayKJOplandDClermontACNaruseKDecreased cardiac expression of vascular endothelial growth factor and its receptors in insulin-resistant and diabetic states a possible explanation for impaired collateral formation in cardiac tissueCirculation2002105337337926 Ueki K, Fruman DA, Yballe CM, Fasshauer M, Klein J, Asano T, et al. Positive and negative roles of p85a and p85ß regulatory subunits of phosphoinositide 3-kinase in insulin signaling. J Biol Chem. 2003;278(48):48453-66.UekiKFrumanDAYballeCMFasshauerMKleinJAsanoTPositive and negative roles of p85a and p85ß regulatory subunits of phosphoinositide 3-kinase in insulin signalingJ Biol Chem200327848484534846627 Yu L, Di W, Dong X, Li Z, Xue X, Zhang J, et al. Diallyl trisulfide exerts cardioprotection against myocardial ischemia-reperfusion injury in diabetic state, role of AMPK-mediated AKT/GSK-3ß/HIF-1a activation. Oncotarget. 2017;8(43):74791-74805.YuLDiWDongXLiZXueXZhangJDiallyl trisulfide exerts cardioprotection against myocardial ischemia-reperfusion injury in diabetic state, role of AMPK-mediated AKT/GSK-3ß/HIF-1a activationOncotarget2017843747917480528 Hayashida R, Kondo K, Morita S, Unno K, Shintani S, Shimizu Y, et al. Diallyl trisulfide augments ischemia-Induced angiogenesis via an endothelial nitric oxide synthase-dependent mechanism. Circ J. 2017;81(6):870-8.HayashidaRKondoKMoritaSUnnoKShintaniSShimizuYDiallyl trisulfide augments ischemia-Induced angiogenesis via an endothelial nitric oxide synthase-dependent mechanismCirc J201781687087829 Hakkila J. Studies on the myocardial capillary concentration in cardiac hypertrophy due to training; an experimental study with guinea pigs. Ann Med Exp Biol Fenn. 1955;33(Suppl 10):1-82.HakkilaJStudies on the myocardial capillary concentration in cardiac hypertrophy due to training; an experimental study with guinea pigsAnn Med Exp Biol Fenn195533Suppl 1018230 Chan YC, Banerjee J, Choi SY, Sen CK. miR 210: The master hypoxamir. Microcirculation. 2012;19(3):215-23.ChanYCBanerjeeJChoiSYSenCKmiR 210: The master hypoxamirMicrocirculation201219321522331 XU L, WANG F, Wei W, DAI W-q, HE S-s, WANG X-p, et al. Effects of hypoxia on the expressions of hypoxia-inducible factor-1 alpha and miR-210 in hepatocellular carcinoma HepG2 cells. Tumor. 2011;31(6):502-7.XULWANGFWeiWDAIW-qHES-sWANGX-pEffects of hypoxia on the expressions of hypoxia-inducible factor-1 alpha and miR-210 in hepatocellular carcinoma HepG2 cellsTumor201131650250732 Wang J, Zhang Y, Liu YM, Guo LL, Wu P, Dong Y, et al. Huoxue Anxin Recipe () promotes myocardium angiogenesis of acute myocardial infarction rats by up-regulating miR-210 and vascular endothelial growth factor. Chin J Integr Med. 2016;22(9):685-90.WangJZhangYLiuYMGuoLLWuPDongYHuoxue Anxin Recipe () promotes myocardium angiogenesis of acute myocardial infarction rats by up-regulating miR-210 and vascular endothelial growth factorChin J Integr Med201622968569033 Greco S, Fasanaro P, Castelvecchio S, D'Alessandra Y, Arcelli D, Di Donato M, et al. MicroRNA dysregulation in diabetic ischemic heart failure patients. Diabetes. 2012;61(6):1633-41.GrecoSFasanaroPCastelvecchioSD'Alessandra Y.Arcelli D.Di Donato MMicroRNA dysregulation in diabetic ischemic heart failure patientsDiabetes20126161633164134 Van Craenenbroeck AH, Ledeganck KJ, Van Ackeren K, Jürgens A, Hoymans VY, Fransen E, et al. Plasma levels of microRNA in chronic kidney disease: patterns in acute and chronic exercise. Am J Physiol Heart Circ Physiol. 2015;309(12):H2008-16.Van CraenenbroeckAHLedeganckKJVan AckerenKJürgensAHoymansVYFransenEPlasma levels of microRNA in chronic kidney disease patterns in acute and chronic exerciseAm J Physiol Heart Circ Physiol201530912H2008H201635 Fernandes T, Baraúna VG, Negrão CE, Phillips MI, Oliveira EM. Aerobic exercise training promotes physiological cardiac remodeling involving a set of microRNAs. Am J Physiol Heart Circ Physiol. 2015;309(4):H543-52.FernandesTBaraúnaVGNegrãoCEPhillipsMIOliveiraEMAerobic exercise training promotes physiological cardiac remodeling involving a set of microRNAsAm J Physiol Heart Circ Physiol20153094H543H55236 Chiang EP, Chiu SC, Pai MH, Wang YC, Wang FY, Kuo YH, et al. Organosulfur garlic compounds induce neovasculogenesis in human endothelial progenitor cells through a modulation of MicroRNA 221 and the PI3-K/Akt signaling pathways. J Agric Food Chem. 2013;61(20):4839-49.ChiangEPChiuSCPaiMHWangYCWangFYKuoYHOrganosulfur garlic compounds induce neovasculogenesis in human endothelial progenitor cells through a modulation of MicroRNA 221 and the PI3-K/Akt signaling pathwaysJ Agric Food Chem201361204839484937 Sorensen CM, Ding J, Zhang Q, Alquier T, Zhao R, Mueller PW, et al. Perturbations in the lipid profile of individuals with newly diagnosed type 1 diabetes mellitus: lipidomics analysis of a Diabetes Antibody Standardization Program sample subset. Clin Biochem. 2010;43(12):948-56.SorensenCMDingJZhangQAlquierTZhaoRMuellerPWPerturbations in the lipid profile of individuals with newly diagnosed type 1 diabetes mellitus lipidomics analysis of a Diabetes Antibody Standardization Program sample subsetClin Biochem2010431294895638 Mohammadi A, Oshaghi EA. Effect of garlic on lipid profile and expression of LXR alpha in intestine and liver of hypercholesterolemic mice. J Diabetes Metab Disord. 2014;13(1):20.MohammadiAOshaghiEAEffect of garlic on lipid profile and expression of LXR alpha in intestine and liver of hypercholesterolemic miceJ Diabetes Metab Disord2014131202039 Riedel S, Radzanowski S, Bowen TS, Werner S, Erbs S, Schuler G, et al. Exercise training improves high-density lipoprotein-mediated transcription of proangiogenic microRNA in endothelial cells. Eur J Prev Cardiol. 2015;22(7):899-903.RiedelSRadzanowskiSBowenTSWernerSErbsSSchulerGExercise training improves high-density lipoprotein-mediated transcription of proangiogenic microRNA in endothelial cellsEur J Prev Cardiol201522789990340 Kostrzewa-Nowak D, Nowak R, Jastrzebski Z, Zarebska A, Bichowska M, Drobnik-Kozakiewicz I, et al. Effect of 12-week-long aerobic training programme on body composition, aerobic capacity, complete blood count and blood lipid profile among young women. Biochem Med (Zagreb). 2015;25(1):103-13.Kostrzewa-NowakDNowakRJastrzebskiZZarebskaABichowskaMDrobnik-KozakiewiczIEffect of 12-week-long aerobic training programme on body composition, aerobic capacity, complete blood count and blood lipid profile among young womenBiochem Med (Zagreb)2015251103113O Efeito do Alho e de Exercícios Físicos Voluntários na Angiogênese Cardíaca no Diabetes: O Papel do miRNA-126 e do miRNA-210NaderiRoya12MohaddesGisou3MohammadiMustafa4AlihemmatiAlireza5KhamanehAmirmahdi6GhyasiRafighe4GhaznaviRana7Nephrology and Kidney Transplant Research Center - Urmia University of Medical Sciences, Urmia - IranDepartment of Physiology, faculty of Medicine - Urmia University of Medical Sciences, Urmia - IranNeuroscience Research Centre of Tabriz University of Medical Sciences, Tabriz - IranDrug Applied Research Center of Tabriz University of Medical Sciences, Tabriz - IranDepartment of Histology and Embryology, Faculty of Medicine, Tabriz University of Medical Sciences, Tabriz - IranSchool of advanced medical sciences - Tabriz University of Medical Sciences, Tabriz - IranSports medicine research center, Neuroscience institute - Tehran University of Medical Sciences, Tehran - IranCorrespondência: Mustafa Mohammadi, Drug Applied Research Center of Tabriz University of Medical Sciences, Tabriz - Iran. E-mail: m.mohammadin@yahoo.com
Contribuição dos autores
Concepção e desenho da pesquisa, análise e interpretação dos dados e análise estatística: Naderi R, Mohaddes G, Mohammadi M; obtenção de dados: Naderi R, Ghaznavi R, Ghyasi R; obtenção de financiamento, redação do manuscrito e revisão crítica do manuscrito quanto ao conteúdo intelectual importante: Naderi R; Achado histológico e interpretação dos dados: Alihemmati A; Contribuiu para o protocolo PCR em tempo real: Khamaneh A.
Potencial conflito de interesses
Declaro não haver conflito de interesses pertinentes.
ResumoFundamento:
O diabetes mellitus (DM) é um dos principais fatores de risco para doenças cardiovasculares, levando à disfunção endotelial e inibição da angiogênese. O miRNA-126 e o miRNA-210 promovem a resposta angiogênica em células endoteliais.
Objetivo:
O presente estudo buscou explorar o efeito do alho e de exercícios físicos voluntários, isoladamente ou em conjunto, nas expressões do miRNA-126 e do miR-210 e na angiogênese cardíaca em ratos com diabetes tipo 1.
Métodos:
Ratos Wistar machos foram divididos em cinco grupos (n = 7): Controle, Diabetes, Diabetes+Alho, Diabetes+Exercícios e Diabetes+Alho+Exercícios. Introduziu-se diabetes nos animais por estreptozotocina (ip, 50 mg/kg). Os ratos foram então alimentados com homogenato de alho fresco cru (250 mg/kg), ou foram submetidos a exercícios voluntários, ou a uma combinação de alho e exercícios voluntários, durante 6 semanas. As expressões do miRNA-126 e do miRNA-210 no miocárdio foram determinadas por PCR em tempo real, e o perfil lipídico sérico foi medido por kits enzimáticos. A angiogênese foi avaliada por imunocoloração por PECAM-1/CD31 no miocárdio
Resultados:
O diabetes reduziu a expressão do miRNA-126 cardíaco e da angiogênese (p < 0,05). Por outro lado, houve um aumento da expressão do miRNA-210 no miocárdio dos animais diabéticos (p < 0,001). No entanto, tais efeitos foram revertidos com alho ou exercícios voluntários (p < 0,01). Além disso, o tratamento de ratos diabéticos conjuntamente com alho e exercícios voluntários teve um efeito adicional sobre as expressões do miRNA-126 e do miRNA-210 (p < 0,001). Além disso, tanto os exercícios voluntários quanto o alho melhoraram significativamente os perfis lipídicos séricos (p < 0,001).
Conclusões:
A indução de diabetes diminuiu a angiogênese no miocárdio, enquanto nosso tratamento com exercícios voluntários de longa duração e alho melhorou a angiogênese miocárdica. Estas alterações devem-se, possivelmente, ao aumento das expressões do miRNA-126 e do miRNA no miocárdio.
Palavras-chave:RatosAlhoAllium SativumExercícioDiabetes MellitusmicroRNAsIndutores da AngiogêneseNeovascularização FisiológicaIntrodução
O diabetes mellitus (DM) é um dos principais fatores de risco para doenças cardiovasculares, levando à disfunção endotelial e à inibição da angiogênese.1 A tendência atual em pesquisas e cuidados médicos concentra-se em fornecer terapias eficazes, com poucos efeitos colaterais e baixa toxicidade, capazes de ser usadas regularmente para o controle das complicações do diabetes.2
O exercício físico é uma poderosa estratégia terapêutica para melhorar a saúde cardiovascular em geral.3 No entanto, exercícios exaustivos podem ser problemáticos, uma vez que podem causar a produção de espécies reativas de oxigênio (ROS).4 Portanto, exercícios voluntários, em que o animal tem livre acesso a uma roda de corrida, podem ser um modelo com efeitos mais positivos.5 Há evidências de que o treinamento aeróbico pode promover a angiogênese cardíaca,6,7 na qual o fator de crescimento endotelial vascular (VEGF) desempenha um papel crítico.5 Entretanto, os mecanismos subjacentes ao exercício físico ainda não foram completamente elucidados.
Uma das plantas mais tradicionais da fitoterapia é o Allium sativum L, sobre o qual já se tem relatado que possui efeitos benéficos para a saúde. É utilizado como agente terapêutico em vários distúrbios, como câncer, doenças cardiovasculares e diabetes, por meio de diferentes mecanismos, incluindo a inibição ou a estimulação da angiogênese.2,8,9 Considerando os efeitos do alho na proteção contra as doenças cardiovasculares, bem como a seus efeitos sobre a angiogênese em diferentes tecidos, é interessante examinar os efeitos do alho sobre a angiogênese miocárdica e os mecanismos a ela relacionados.
Os miRNAs são pequenos RNAs não codificadores que funcionam no silenciamento do RNA e na regulação pós-transcricional da expressão gênica.10 Os miRNAs são mediadores intracelulares essenciais em muitos processos, como a inflamação, o metabolismo mitocondrial, a apoptose e a angiogênese, que podem ser ajustados por meio de exercícios.11 Portanto, os miRNAs podem ser clinicamente úteis no tratamento de vários distúrbios. Além disso, os miRNAs são liberados na urina e na corrente sanguínea após a ocorrência de lesão tecidual, tornando-se biomarcadores úteis à detecção precoce, diagnóstico e prognóstico de distúrbios. Recentemente, descobriu-se que essas moléculas estão envolvidas em doenças cardiovasculares.12 Isso inclui uma expressão elevada de miRNA-126 no endotélio cardíaco, bem como seu envolvimento na angiogênese.12,13 Os níveis circulantes de miRNA-126 encontram-se reduzidos no diabetes,14,15 sugerindo que sua deficiência pode prejudicar a vascularização.16 Além disso, segundo Fasanaro et al.,17 o miRNA-210 induzido por hipóxia contribui para a resposta angiogênica em células endoteliais, e que seu bloqueio por transfecção de anti-miRNAs inibe a formação de estruturas semelhantes a capilares.17
É bem sabido que muitas complicações do diabetes estão associadas a distúrbios lipídicos. De fato, a dislipidemia prejudica vários órgãos e é reconhecida como um importante fator de muitas complicações diabéticas, incluindo anormalidades vasculares.18
Portanto, o objetivo deste estudo foi investigar o efeito dos exercícios voluntários e do tratamento com alho, isolados ou conjuntamente, sobre as expressões do miRNA-126 e miRNA-210, sobre o perfil lipídico sérico, e também sua relação com a angiogênese cardíaca no diabetes.
MétodosOs animais e o desenho experimental
O Comitê de Ética em Experimentação Animal aprovou o plano de estudo, e todos os experimentos foram conduzidos de acordo com o National Institute of Health’s Guide for the Care and Use of Laboratory Animals. Ratos Wistar machos (200 - 250 g) foram fornecidos pela colônia da nossa universidade. Todos os animais foram alojados em uma instalação com temperatura controlada (21-23°C), mantida em ciclo claro-escuro de 12:12h, com alimento e água disponíveis ad libitum.
Neste estudo, trinta e cinco ratos machos foram divididos em cinco grupos (n = 7): Controle, Diabetes, Diabetes+Alho, Diabetes+Exercícios e Diabetes+Alho+Exercícios. Os animais de controle receberam 0,4 mL de tampão de citrato de sódio, pH 4,5. O diabetes foi induzido utilizando-se uma dose intraperitoneal única (50 mg/kg) de Estreptozotocina (Sigma, St. Louis, Mo, EUA). O nível de glicose no sangue foi medido 72 horas depois, utilizando um glicosímetro (Elegance, Modelo No. CT-X10 Alemanha), e o diabetes induzido era identificado se o nível de glicose no sangue fosse > 300 mg/dL (16,67mmol/L).
Neste estudo, o tamanho da amostra foi determinado com base em nossos estudos prévios similares.8,19
Exercícios voluntários
Os ratos dos grupos de exercício voluntário foram alojados individualmente em gaiolas contendo rodas de corrida de aço inoxidável (1,00m de circunferência, TajhizGostar) e tiveram livre acesso à roda 24h por dia, durante 6 semanas. A distância de corrida foi monitorada diariamente. Se a distância de corrida fosse inferior a 2.000 m/dia, o animal era excluído do estudo. Ratos sedentários foram alojados em gaiolas-padrão, sem rodas de corrida, durante o mesmo período.
O preparo do homogenato de alho
Cabeças de alho (Allium sativum) foram compradas em um mercado local. Os dentes foram descascados, fatiados, moídos e depois dissolvidos em água destilada. O homogenato de alho foi preparado todos os dias.
Amostragem
No final da 6a semana, os ratos foram profundamente anestesiados com pentobarbital sódico (35 mg/kg, i.p.), foram coletadas amostras de sangue da veia cava inferior para a medição do perfil lipídico.
Em seguida, o coração foi rapidamente removido através de toracotomia mediana, e o ventrículo esquerdo foi excisado, congelado em nitrogênio líquido e armazenado em congelamento (-70°C) para medições posteriores. O miocárdio foi utilizado para extração de miRNA, estudo de PCR em tempo real e determinação da angiogênese.
Extração do miRNA e PCR em tempo real
O miRNA foi extraído do miocárdio utilizando-se um kit de isolamento miRCURYTMRNA (Exiqon, Vedbaek, Dinamarca) conforme o protocolo do fabricante.20,21 O procedimento foi realizado com base em coluna de spin, utilizando-se uma resina proprietária como matriz para separar o RNA de outros componentes celulares. O conteúdo a pureza do RNA foram medidos com o espectrofotômetro Nanodrop 1000 (Thermo scientific, Wilmington, DE 19810 EUA). O perfil de expressão do MiRNA-126 foi obtido para os extratos de RNA total utilizando-se um kit universal de síntese de cDNA. Resumidamente, o RNA total contendo microRNA foi poliadenilado, e o cDNA foi sintetizado utilizando-se um iniciador poli(T) com uma âncora 3’ degenerada e um marcador universal 5’ (Exiqon, Vedbaek, Dinamarca). Cada cDNA foi utilizado como matriz para PCR quantitativo em tempo real de microRNA, utilizando-se a mistura principal SYBR Green (Exiqon, Vedbaek, Dinamarca). Os conjuntos de iniciadores diretos e reversos de ácido nucléico bloqueado (LNA) (Exiqon, Vedbaek, Dinamarca) para microRNA estão listados na Tabela 1. As reações de PCR em tempo real foram realizadas com um sistema de detecção Bio-Rad iQ5 (Bio-Rad, Richmond, CA, EUA). A quantidade de produtos de PCR foi normalizada com rno-miRNA-191 para o miRNA-126 e o miRNA-210.37 Utilizamos o método 2-(ΔΔCt) para determinar os níveis quantitativos relativos de miRNA-126 e miRNA-210. Os resultados foram expressos como diferença (razão) em relação os controles relevantes.
Lista de sequências-alvo para os miRNAs
Nome do gene
Número de acesso
Sequência-alvo*
rno-miRNA-191
MIMAT0000440
CAACGGAAUCCCAAAAGCAGCUG
hsa-miRNA-126
MIMAT0002957
UCGUACCGUGAGUAAUAAUGC
dme-miRNA- 210
MIMAT0001233
UUGUGCGUGUGACAGCGGCUA
As sequências foram obtidas no miRNABase (www.mirbase.org).
Imunocoloração para PECAM-1/CD31
Para investigar a angiogênese no miocárdio, secções transversais dos ventrículos, realizadas em sua porção intermediária, foram imediatamente isoladas e fixadas em solução de formalina tamponada a 10%, desidratadas em graus ascendentes de álcool e embebidas em parafina. Em seguida, cortes seriais de 3µm de espessura foram cortados e flutuados em lâminas de vidro carregadas conforme o processamento histológico padrão. Os pedaços de tecido foram desparafinados em xileno e desidratados em uma série graduada de etanol. As lâminas foram incubadas sequencialmente em proteinase K e 0,3% de peróxido de hidrogênio, para bloquear a atividade da peroxidase endógena. As secções foram cobertas pelo anticorpo primário CD31 (Santa Cruz, EUA) - um marcador de angiogênese - e incubadas a +4 °C durante a noite. Depois, as secções foram lavadas e incubadas com complexo avidina-biotina padrão (ABC; Santa Cruz) conforme o protocolo. Em seguida, as lâminas foram incubadas em DAB (Diamino-benzidina, Santa Cruz) como cromato, e contra-coradas com a hematoxilina de Mayer. Finalmente, as secções foram limpas em xileno, montadas com Entellan e analisadas com um microscópio de luz.
Avaliação de imunocoloração
Para avaliar a imunocoloração, 3 a 5 secções de 1 mm2 foram selecionadas aleatoriamente em uma ampliação de 400×, dependendo do tamanho da secção da amostra. Tanto a intensidade da coloração quanto o número de células positivas foram avaliados semi-quantitativamente. A classificação da intensidade de coloração do CD31 foi obtida dentro de cada área, em uma ampliação de 400x. Cada aglomerado de células endoteliais com CD31 expressando imunorreatividade, bem como lúmen ou vasos em formação, foram contados como microvasos individuais. Estruturas vasculares positivas para CD31 foram contadas para 5 a 6 lâminas por animal e 10 campos por lâmina.
Para avaliar a imunocoloração, utilizou-se o tecido de granulação como controle positivo, e a intensidade da coloração foi classificada da seguinte forma: 0 (< 10%); 1 (10% a 25%); 2 (25% a 50%); 3 (50% a 75%) ou 4 (75% a 100%).22
Medição do perfil lipídico
Amostras de sangue foram obtidas da veia cava inferior, centrifugadas a 3500 rpm, por 10 minutos, a 4°C, e o soro foi coletado. O nível sérico de triglicerídeos foi determinado por kits enzimáticos (ZiestChem Diagnostic kits, Irã), utilizando-se o glicerol como padrão. Adicionalmente, os níveis de lipoproteína de alta densidade (HDL) e lipoproteína de baixa densidade (LDL) foram determinados com base em métodos enzimáticos através de kits de diagnóstico, (ZiestChem, Irã) utilizando-se o colesterol como padrão.
Análise estatística
Todos os resultados foram expressos como média ± EPM para sete animais, e as análises foram realizadas com o software estatístico SPSS, versão 16. Todos os parâmetros foram testados para normalidade usando o teste de Kolmogorov-Smirnov de uma amostra. Os dados foram analisados estatisticamente utilizando-se a análise de variância unidirecional (ANOVA) seguida do teste de Tukey. O nível de significância foi estabelecido em p < 0,05.
ResultadosEfeitos do alho e dos exercícios voluntário sobre o miRNA-126 no miocárdio
Como mostrado na Figura 1, o nível de expressão do miRNA-126 no miocárdio foi significativamente mais baixo (p < 0,05) em ratos com diabetes do que no grupo controle. O tratamento com alho (p < 0,001), exercício voluntário (p < 0,01), ou ambos em conjunto aumentaram significativamente (p < 0,001) a expressão do miRNA-126 no miocárdio em ratos diabéticos em comparação com o grupo diabético. Além disso, o grupo Diabetes+Alho+Exercícios apresentou um nível significativamente maior de expressão de miRNA-126 em comparação com o grupo apenas de tratamento de alho (p < 0,05) e o grupo apenas de exercícios voluntários (p < 0,01) em animais diabéticos.
Análise de PCR quantitativo em tempo real de miRNA-126 no tecido cardíaco dos grupos experimentais. Os valores representam médias ± S.E.M para 7 animais. *p < 0,05 vs. grupo controle, <sup>$$</sup>p < 0,01 e <sup>$$$</sup>p < 0,001 vs. grupo diabetes, <sup>&&</sup> p < 0,01 vs. grupo Diabetes+Exercícios, e <sup>#</sup>p < 0,05 vs. grupo Diabetes+Alho.
Efeitos do alho e dos exercícios voluntário sobre o miRNA-210 no miocárdio
Como mostrado na Figura 2, a expressão do miRNA-210 aumentou significativamente (p < 0,001) em animais com diabetes, em comparação com o grupo controle. O tratamento com alho (p < 0,01), exercícios voluntários (p < 0,01) ou ambos combinados reduziram significativamente (p < 0,001) a expressão do miRNA-210 no miocárdio em ratos diabéticos, em comparação com o grupo diabético. O grupo combinado Alho+Exercícios reduziu significativamente a expressão do miRNA-210 em comparação com os grupos Diabetes+Exercícios (p < 0,05) e Diabetes+Alho (p < 0,01).
Análise de PCR quantitativo em tempo real de miRNA-210 no tecido cardíaco dos grupos experimentais. Os valores representam médias ± S.E.M para 7 animais. ***p < 0,001 vs. grupo controle, <sup>$$</sup>p < 0,01 e <sup>$$$</sup>p < 0,001 vs. grupo diabetes, <sup>&</sup>p < 0,05 vs. grupo Diabetes+Exercícios, e <sup>##</sup>p < 0,01 vs. grupo Diabetes+Alho.
Efeitos do alho e dos exercícios voluntário sobre a angiogênese no miocárdio
Realizou-se a imunocoloração com o marcador CD31 para a avaliação da angiogênese na secção transversal da porção média dos ventrículos. Os tecidos corados em marrom mostram células endoteliais imunocoradas pelo CD-31. Na Figura 4, os graus de intensidade de coloração são classificados da seguinte forma: 0 (<10%); 1 (10% a 25%); 2 (25% a 50%); 3 (50% a 75%) ou 4 (75% a 100%). Conforme mostrado nas Figuras 3 e 4, a análise estatística de nosso estudo imuno-histoquímico revelou que a angiogênese diminuiu significativamente (p < 0,01) no grupo diabético em comparação com grupo controle. Seis semanas de tratamento com alho, com exercícios voluntários ou com ambos em conjunto nos grupos com diabetes aumentaram significativamente (p < 0,001) a angiogênese no ventrículo esquerdo, em comparação com o grupo com diabetes (Figuras 3 e 4). A combinação de consumo de alho e exercício em animais diabéticos induziu mais angiogênese em comparação com apenas alho e apenas exercícios, embora a diferença não fosse significativa.
Detecção imuno-histoquímica de CD31 nos vasos miocárdicos dos diferentes grupos. Tecidos corados em marrom mostram células endoteliais CD-31 imunocoradas em: (A) Controle; (B) Diabetes; (C) Diabetes+Alho; (D) Diabetes+Exercícios; e (E) Diabetes+Alho+Exercícios. A intensidade da imunocoloração para o CD31 (pontas das setas) diminuiu no grupo Diabetes em comparação com o grupo Controle. O tratamento com alho e exercícios, separadamente ou em conjunto, aumentaram a angiogênese no diabetes em comparação com o grupo diabético (a ampliação foi de 400x).
Efeitos do tratamento com alho e exercícios voluntários na angiogênese em diferentes grupos experimentais. A intensidade da coloração foi classificada como: 0 (< 10%); 1 (10-25%); 2 (25-50%); 3 (50 a 75%); e 4 (75-100%). Os valores representam médias ± S.E.M para 7 animais. **p < 0,01 vs. grupo controle e <sup>$$$</sup>p < 0,001 vs. grupo diabetes.
Efeitos do alho e dos exercícios voluntário sobre o perfil de lipídio sérico
As alterações no perfil lipídico dos diferentes grupos são mostradas na Tabela 2. A indução do diabetes nos animais aumentou significativamente (p < 0,001) os níveis séricos de TGs e LDL, enquanto houve redução nos níveis séricos de HDL e HDL/LDL em comparação com os animais controle. Exercícios voluntários reduziram significativamente (p < 0,05) os níveis séricos de triglicérides no grupo diabético, em comparação com o grupo controle. Seis semanas de tratamento com apenas alho ou apenas exercícios voluntários diminuíram significativamente (p < 0,01) os níveis de triglicérides nos animais com diabetes. Nestes, os níveis de LDL no soro diminuíram significativamente (p < 0,001) após somente alho e somente exercícios ou uma combinação dos ambos. No entanto, o nível sérico de HDL foi significativamente aumentado (p < 0,001) pelo tratamento com alho, exercícios voluntários ou a combinação de ambos em ratos diabéticos. Além disso, a razão HDL:LDL foi significativamente maior (p < 0,001) nos grupos Diabetes+Alho, Diabetes+Exercícios e Diabetes+Alho+Exercícios em comparação com o grupo diabético.
Perfis lipídicos séricos nos diferentes grupos após 6 semanas (Média ± SEM, n = 7)
Variantes
Controle
Diabetes
Diabetes+ Alho
Diabetes+ Exercícios
Diabetes+Alho +Exercícios
TG (mg/dl)
21,3 ± 2,9
87,8 ± 14,3***
42 ± 2,9$$
50,1 ± 9,3$
44,8 ± 3,7$$
LDL (mg/dl)
41 ± 1,69
48,87 ± 1,21***
38,66 ± 0,61$$$
39 ± 0,81$$$
38,33 ± 0,76$$$
HDL (mg/dl)
28,8 ± 1,07
18,25 ± 0,83***
28,16 ± 1,22$$$
26,66 ± 1,47$$$
27 ± ,1,46$$$
HDL/LDL
0,7 ± 0,03
0,36 ± 0,01***
0,72 ± 0,03$$$
0,67 ± 0,03$$$
0,7 ± 0,04$$$
p < 0,001 vs. grupo controle e
p < 0,001 vs. grupo diabetes. TG: triglicerídeos; HDL: lipoproteína de alta densidade; LDL: lipoproteína de baixa densidade.
Discussão
O presente estudo mostrou que a indução de diabetes prejudicou o perfil lipídico sérico, diminuiu a angiogênese miocárdica e a expressão do miRNA-126 e aumentou a expressão miocárdica do miRNA-210. No entanto, o tratamento somente com alho, somente com exercícios voluntários ou com ambos em conjunto melhoraram esses efeitos no miocárdio de animais diabéticos. Curiosamente, tratar ratos diabéticos simultaneamente com alho e exercícios voluntários teve um efeito adicional sobre a expressão cardíaca do miRNA-126 e do miRNA-210. Em sintonia com o nosso estudo, pesquisas têm demonstrado que o diabetes leva a um prejuízo da função das células progenitoras endoteliais precoces, resultando em uma capacidade reduzida de neovascularização e angiogênese no miocárdio de ratos diabéticos.23 O VEGF, como indutor de angiogênese, é um mitógeno altamente específico para células endoteliais.24 Sabe-se que a expressão do VEGF-A e de seus receptores diminui no miocárdio de ratos e humanos diabéticos.25 Entretanto, o processo propriamente dito do VEGF e redução de angiogênese no coração diabético ainda não foi totalmente elucidado.
Existe uma variedade de miRNAs no tecido cardíaco, e esses minúsculos reguladores são reconhecidos como novos alvos/medicamentos em vários campos, incluindo a cardiologia.12 O MiRNA-126 é conhecido como um miRNA específico do endotélio, modulador da angiogênese in vivo. Vários estudos demonstraram que o miRNA-126 contribui para a homeostase endotelial e a angiogênese,12,13,15 a qual é mediada por SPRED1 e PIK3R2 na promoção da sinalização do VEGF.15 Além disso, o miRNA-126 ativa quinases de sobrevivência, tais como a ERK e a Akt, por meio da regulação negativa de seus alvos e pela promoção da ação do VEGF.26 Osipova e colaboradores relataram em seu estudo que os níveis de miRNA-126 na urina encontravam-se reduzidos nos pacientes com diabetes; entretanto, os níveis circulantes de miRNA-126 no plasma não mostraram diferença significativa.1
Há pouca informação disponível sobre a expressão do miRNA no miocárdio de ratos diabéticos em resposta a exercícios voluntários. Curiosamente, no presente estudo, observamos que o alho, os exercícios voluntários e a combinação de ambos aumentaram os níveis de expressão do miRNA-126 e a angiogênese no miocárdio. Efeitos cardioprotetores do alho têm sido relatados em alguns estudos relacionados à melhora das atividades antioxidantes,8 ativação de AKT/GSK-3β/HIF-1α mediada por AMPK,27 e vias de sinalização Akt-eNOS.28 Além disso, em sintonia com nossos resultados, Silva et al.,6 mostraram que exercícios aeróbicos em ratos saudáveis aumentaram a expressão do miRNA-126 no miocárdio, possivelmente relacionada à angiogênese cardíaca induzida por exercícios.6 Ademais, estudos demonstraram que exercícios físicos aumentam a angiogênese no coração, tanto em condições saudáveis29 como patológicas,5,7 o que destaca o efeito positivo da atividade física como ferramenta não farmacológica no tratamento de doenças cardiovasculares. Considerando-se o aumento da expressão do miRNA-126 após exercícios voluntários, a angiogênese cardíaca possivelmente está relacionada à expressão do miRNA-126 induzida por exercícios e à modulação do VEGF, que regula positivamente vias angiogênicas como o MAPK e PI3K/Akt/eNOS.6
Importante miRNA induzido por hipóxia, o miRNA-210 é estimulado após a hipóxia e a ativação do HIF.30 A elevação da expressão do miRNA-210 é evidência de condições hipóxicas no músculo cardíaco, no qual a hipóxia estimula uma série de respostas fisiológicas, como a angiogênese através da expressão aumentada do miRNA-210 induzida por HIF-1α.31 A expressão positiva do MiRNA-210 é um elemento importante da resposta das células endoteliais à hipóxia, o que leva à angiogênese por meio de seu gene-alvo, Efrina-A3.17 Já foi demonstrado que a regulação positiva do miRNA-210 e do VEGF aumenta a angiogênese do miocárdio no infarto agudo do miocárdio em resposta a Receita de Anoxina Huoxue (HAR).32 Greco et al.,33 descreveram que, além da hipóxia, a hiperglicemia é outro estimulador que regula positivamente a expressão do miRNA-210, o que se observa no diabetes.33 Osipova et al.,1 mostraram que o nível de miRNA-210 encontrava-se elevado no plasma e na urina de crianças diabéticas do tipo,1 bem como nos cardiomiócitos e células endoteliais de pacientes diabéticos.33 Em sintonia com esses estudos, mostramos que a indução de diabetes aumentou o nível de miRNA-210 no miocárdio, e que esse nível foi reduzido tanto por alho quanto por exercícios voluntários e pela combinação de ambos. Da mesma forma, um estudo recente demonstrou que os níveis plasmáticos de miRNA-210 diminuíram na doença renal crônica após exercícios agudos.34 Em contraste, alguns estudos mostraram que o miRNA-210 não se mostrava responsivo no tecido cardíaco durante exercícios agudos e exaustivos e durante exercícios aeróbicos sustentados11 e natação.35 Além disso, tanto o alho quanto os exercícios demonstraram estar envolvidos na obtenção de um bom controle glicêmico e na prevenção de complicações diabéticas no longo prazo.3,8,19 Portanto, no presente estudo, a diminuição da expressão do miRNA-210 de volta aos níveis normais parece dever-se ao controle glicêmico. Além disso, a angiogênese mediada pelo extrato de alho ocorre provavelmente através da regulação positiva da expressão da proteína c-kit neovasculogênica e da ativação das vias de sinalização PI3-K / K/Akt/NF-κB,36 que regulam a ativação da e-NOS e produção de NO.11
A hiperglicemia é atualmente considerada a principal responsável pela alteração do perfil lipídico. Em geral, a dislipidemia está bem confirmada no diabetes mellitus; ela é conhecida como critério para o diagnóstico de diabetes tipo I e potencial lipotoxina de células beta.37 Vale ressaltar que a dislipidemia está relacionada à aterosclerose e ao risco de doenças cardíacas.37 A dislipidemia é possivelmente mediada pela alteração da expressão da LXRα no fígado e intestino, ativação das vias da nicotinamida adenina dinucleotídeo fosfato (NADPH) oxidase e pela consequente inibição da atividade da eNOS, causando comprometimento da angiogênese.15,38 Além disso, a dislipidemia está relacionada à diminuição dos níveis de miRNA-126 circulante.13 Riedel et al.,39 demonstraram que os exercícios em pacientes com insuficiência cardíaca crônica melhoraram significativamente a expressão de miRNA-126 induzida por HDL.39 Neste estudo, o tratamento com alho e exercícios voluntários, separadamente ou em conjunto, melhoraram o perfil lipídico no soro de ratos diabéticos, o que está de acordo com estudos anteriores.6,9,40 Portanto, o alho e os exercícios possivelmente modularam a angiogênese no miocárdio dos animais diabéticos, modulando o perfil lipídico sérico e a expressão de miRNAs pró-angiogênicos. Com relação às limitações deste estudo, não mensuramos outros fatores envolvidos na angiogênese. Mais estudos são necessários para esclarecer os mecanismos fisiopatológicos do alho e dos exercícios voluntários no tratamento de complicações diabéticas.
Conclusão
Este estudo mostrou que o alho e os exercícios voluntários modularam o perfil lipídico sérico e a expressão do miRNA-126, miRNA-210, aumentando assim a angiogênese no miocárdio de ratos diabéticos. Esses achados sugerem que o alho e os exercícios voluntário, separadamente ou em conjunto, podem trazer benefícios no tratamento do diabetes.
Fontes de financiamento
O presente estudo foi financiado por uma bolsa do Drug Applied Research Center, Tabriz University of Medical Sciences.
Vinculação acadêmica
Este artigo é parte de tese de Doutorado de Roya Naderi pela Drug Applied Research Center, Tabriz University of Medical Sciences.
Aprovação ética e consentimento informado
Este estudo foi aprovado pela Comissão de Ética em Experimentação Animal do Tabriz University of Medical Sciences sob o número de protocolo 91.4-2.4.