Arq Bras Cardiol abc Arquivos Brasileiros de Cardiologia Arq. Bras. Cardiol. 0066-782X 1678-4170 Sociedade Brasileira de Cardiologia - SBC QJWw5P7ZZYJXXbCzBYbCwNz S0066-782X2017001300307 10.5935/abc.20170137 S0066-782X2017005018103 Original Article Angiotensin-Converting Enzyme ID Polymorphism in Patients with Heart Failure Secondary to Chagas Disease Silva Silene Jacinto da 1 Rassi Salvador 1 Pereira Alexandre da Costa 2 Universidade Federal de Goiás Faculdade de Medicina Ciências da Saúde Goiânia GO Brazil Ciências da Saúde - Faculdade de Medicina - Universidade Federal de Goiás, Goiânia, GO – Brazil Universidade Federal de Goiás Universidade de São Paulo Faculdade de Medicina Hospital das Clínicas São Paulo SP Brazil Instituto do Coração (Incor) do Hospital das Clínicas da Faculdade de Medicina da Universidade de São Paulo (HCFMUSP), São Paulo, SP - Brazil Universidade de São Paulo Mailing Address: Silene Jacinto da Silva. Av. Joaão Rita Dias, Q 105 LT 06. Postal Code 74455-360, Jardim Leblon, Goiânia, GO - Brazil. E-mail: silenejacintoa@gmail.com

Author contributions

Conception and design of the research, acquisition of data and statistical analysis: Silva SJ; Analysis and interpretation of the data and writing of the manuscript: Silva SJ, Rassi S, Pereira AC; Obtaining financing: Silva SJ, Pereira AC; Critical revision of the manuscript for intellectual content: Rassi S, Pereira AC.

Potential Conflict of Interest

No potential conflict of interest relevant to this article was reported.

 28 09 2017 10 2017 109 4 307 312 20 04 2017 13 06 2017 04 07 2017 This is an open-access article distributed under the terms of the Creative Commons Attribution License Abstract Background:

Changes in the angiotensin-converting enzyme (ACE) gene may contribute to the increase in blood pressure and consequently to the onset of heart failure (HF). The role of polymorphism is very controversial, and its identification in patients with HF secondary to Chagas disease in the Brazilian population is required.

 Objective:

To determine ACE polymorphism in patients with HF secondary to Chagas disease and patients with Chagas disease without systolic dysfunction, and to evaluate the relationship of the ACE polymorphism with different clinical variables.

 Methods:

This was a comparative clinical study with 193 participants, 103 of them with HF secondary to Chagas disease and 90 with Chagas disease without systolic dysfunction. All patients attended the outpatient department of the General Hospital of the Federal University of Goias general hospital. Alleles I and D of ACE polymorphism were identified by polymerase chain reaction of the respective intron 16 fragments in the ACE gene and visualized by electrophoresis.

 Results:

In the group of HF patients, 63% were male, whereas 53.6% of patients with Chagas disease without systolic dysfunction were female (p = 0,001). The time from diagnosis varied from 1 to 50 years. Distribution of DD, ID and II genotypes was similar between the two groups, without statistical significance (p = 0,692). There was no difference in clinical characteristics or I/D genotypes between the groups. Age was significantly different between the groups (p = 0,001), and mean age of patients with HF was 62.5 years.

 Conclusion:

No differences were observed in the distribution of (Insertion/Deletion) genotype frequencies of ACE polymorphism between the studied groups. The use of this genetic biomarker was not useful in detecting a possible relationship between ACE polymorphism and clinical manifestations in HF secondary to Chagas disease.

 Keywords: Chagas Disease Polymorphism, Genetic Heart Failure Chagas Cardiomyopathy Introduction

Chagas disease has characteristics of an endemic disease and is an important cause of dilated heart disease and heart failure (HF) in regions of low socioeconomic level, leading to high mortality and morbidity rates. Early diagnosis and treatment are important to improve survival rates and quality of life.1

Chagas disease was considered the main cause of HF in central-western region of Brazil.2,4 Sudden cardiac death affects approximately 50% of patients with HF secondary to Chagas disease.5

Most human health problems, including HF, have a multifactorial etiology, influenced by environmental and genetic factors, and life style. Multifactorial disorders are characterized by phenotypic contributions of several genes that interact to each other and to environmental factors. Many disorders manifested in adults are inherited in an autosomal dominant fashion, including familial cardiomyopathy.6

Angiotensin-converting enzyme (ACE) gene (21 kb) is located in the chromosome 17, long arm, region 23, and contains 24 introns.7 It would be ideal to predict the individual response to therapy as well as the potential adverse effects of drugs in the treatment of HF. With advances in molecular biology and genetics, there has been an increasing need for a redefinition of diseases based on their biochemical processes rather than their phenotypic features. Hence, knowledge and treatment of heart diseases, and isolation and characterization of the genes involved may not be a panacea anymore, but rather, a starting point for an individualized treatment.

In this context, the present study aimed to determine the distribution of the ACE gene polymorphism (I/D) in HF secondary to Chagas Disease, compare it with that in Chagas Disease patients free of systolic dysfunction, and evaluate its relationship with clinical variables.

Ethical aspects

The study was analyzed and approved by the Research Ethics Committee of the General Hospital of the Federal University of Goias on December 16th, 2014 (approval number 908870).

 Study design

This was a comparative, clinical study conducted with two groups of patients (group A and group B) attending the cardiology and the Chagas disease outpatient clinics of the General Hospital of the Federal University of Goias. Patients were recruited to the study from February 2014 to October 2015.

 Patients

A total of 193 outpatients were consecutively recruited, 103 with chagasic heart disease (group A) and 90 Chagas disease patients without systolic dysfunction (group B).

 Inclusion criteria

Group A: patients with symptomatic HF (according to Framingham criteria) secondary to Chagas disease; group B: patients with diagnosis of Chagas disease, free of systolic dysfunction.

 Exclusion criteria

Cardiac dysfunction in group B.

 Clinical and laboratory parameters

All clinical data were collected from patients' medical records. Recent laboratory, echocardiography and Doppler echocardiography results were used to determine patients' current health status.

In HF patients, functional class was determined using the New York Heart Association criteria, by the outpatient medical staff. With respect to Doppler echocardiography, the following parameters were analyzed: left atrium (LA), left ventricular systolic diameter (LVSD), left ventricular diastolic diameter (LVDD), and left ventricular ejection fraction (LVEF).

 Genotyping

Eight-mL blood samples were collected and stored in two tubes containing EDTA anticoagulant. Then, DNA extraction was performed, followed by ACE polymorphism genotyping by polymerase chain reaction (PCR), which was classified as D/D (deletion/deletion), I/D (insertion/deletion) or I/I (insertion/insertion).

Genotyping method was adapted from Lindpaintner et al.8 For a final volume of 25 µL, 1 mM of primers, 200 mM of nucleoside triphosphates (dATP, dCTP, dGTP, dTTP), 1.3 mM of magnesium chloride, 50 mM of potassium chloride, 0.5 unit of Taq DNA polymerase and 20 ng of DNA were added. The sense primer GCCCTGCAGGTGTCTGCAGCATGT and the antisense primer GGATGGCTCTCCCCGCCTTGTCTC were used to amplify the alleles D and I, resulting in amplicons of 319 pb and 597 pb, respectively. The protocol of DNA amplification was composed of an initial denaturation at 94ºC for 5 minutes, followed by 35 cycles - 30 seconds at 94ºC, 45 seconds at 56ºC, 2 minutes at 72ºC. Then, the amplification products of D and I alleles were subjected to 1.5% agarose gel electrophoresis stained with 0.5 mg/mL ethidium bromide for 10 minutes. Due to the preferential amplification of D allele in heterozygous samples, all samples with a DD genotype were reanalyzed using the primers TGGGACCACAGCCGCGCCTACCAC and TCGGCCCTCCCACCACCATGCTAA (sense and antisense, respectively), at the same conditions of PCR, except for the annealing temperature of 67ºC. Analysis of the PCR products by 1.5% agarose gel electrophoresis revealed an amplicon of 335pb with the allele I. The results were captured using the Image Master VDS® video documentation system (Pharmacia Biotech, EUA).

 Statistical analysis

Descriptive analysis was used for characterization of the variables - categorical variables were described in percentages; continuous variables with normal distribution were described in mean ± standard deviation, and continuous variables without normal distribution were described in median and interquartile ranges. The Kolmogorov-Smirnov Z test was used to identify those variables with a normal distribution. Differences between groups A and B were calculated using the chi-square test or the unpaired Student's t-test, and the Mann-Whitney test as appropriate. The association between the variables of exposure to HF was measured by Odds Ratio (OR) and respective 95% confidence intervals. Differences between the groups were considered statistically significant when p < 0.05. Analyses were performed using the SPSS program, version 18.0.

 Results

There was a significant difference in sex distribution between the groups (p = 0.023), and 63% of HF patients were men. Mean age of HF patients was 62.5 years ± 11.1 years, with significant difference between the groups (p = 0.00). Sociodemographic and clinical characteristics of patients are described in Table 1.

Sociodemographic and clinical characteristics of the sample
Variables Group A Group B OR 95CI% p-value
n % n %
Sex
Male 51 63.0 30 37.0 1.96 1.09-3.52 0.023a
Female 52 46.4 60 53.6
Mean age (SD) 62.5 (11.1) 51.3 (11.9) 0.000b
Origin
Goiania 59 54.6 49 45.4 1.12 0.64-1.98 0.692a
Others 44 51.8 41 48.2
Median time elapsed from diagnosis of Chagas disease(interquartile range) 15 (8-25) 9.5 (5-17) 0.002c
Smoking
Yes 30 73.2 11 26.8 2.95 1.38-6.32 0.004a
No 73 48.0 79 52.0
Alcohol consumption
Yes 21 42.0 29 58.0 0.34 0.28-1.03 0.061a
No 82 57.3 61 42.7
Median heart rate (interquartile range) (bpm) 65 (60-80) 65 (60-80) 0.290c
Megaesophagus
Yes 18 38.3 29 61.7 0.45 0.23-0.87 0.017a
No 85 58.2 61 41.8
Megacolon
Yes 9 64.3 5 35.7 1.63 0.53-5.05 0.395a
No 94 52.5 85 47.5
Dyslipidemia
Yes 15 75.0 5 25.0 2.90 1.01-8.32 0.041a
No 88 50.9 85 49.1
Diabetes mellitus
Yes 6 54.5 5 45.5 1.05 0.31-3.57 0.936a
No 97 53.3 85 46.7

SD: standard deviation; Group A: patients with heart failure secondary to Chagas disease; Group B: patients with Chagas disease free of systolic dysfunction; bpm: beats per minute; OR: odds ratio;

chi-square test;

unpaired t-test;

Mann Whitney test

All patients with HF were receiving drug treatment and 73.2% were smokers, which was statistically different from group B (p = 0.004). With respect to the comorbidities associated with HF, there was a predominance of dyslipidemia (75%). Mean heart rate was higher in HF patients (p = 0.030) as compared with group B.

Megaesophagus was prevalent in group B only (61.7%), with significant difference between the groups (p = 0.017). The time elapsed since the diagnosis of Chagas disease was also statistically different between the groups (p = 0.001).

Genetic profile of the study population

In order to determine the prevalence of ACE polymorphism genotype between groups A and B, we analyzed the frequency of the DD, ID and II genotypes (Table 2). There was no statistically significant difference in the observed-to-expected genotype frequencies between the groups (0.692).

I/D polymorphism in groups A and B
Genotype Group A Group B p-value
N % N %
DD 17 50.0 17 50.0 0.692a
ID 59 56.2 46 43.8
II 27 50.0 27 50.0

DD: deletion/deletion; ID: insertion/deletion; II-insertion/insertion; group A: patients with heart failure secondary to Chagas disese; Group B: patients with Chagas disease without systolic dysfunction.

chi-square test;

Mean values of echocardiographic variables and genotypes were not statistically different between the groups. ID genotype carriers had greater mean LVDD as compared with other genotype carriers.

With respect to repeated measures of categorical data, there was no significant difference in functional class or I/D genotype (p = 0.472) between the groups. There were only four patients in functional class IV; functional class II was present in 86 patients, 52.3% of them belonged to ID genotype.

Megaesophagus was present in group B, with no difference in the number of patients with and without megaesophagus. Dyslipidemia was associated with a 5-time increased risk for HF patients. Genotypes DD, ID and II were not considered as a risk factor for HF, since their distribution was not statistically different between the groups.

 Discussion

There are many conflicting results in the literature on what polymorphisms are involved in the susceptibility to the development and worsening of HF. In the present study, the role of ACE gene polymorphism (I/D) in patients with chagasic heart disease and in Chagas disease patients free of systolic dysfunction. In this population, ACE polymorphism was not associated with sociodemographic and clinical characteristics.

Male gender was predominant (63%) in our sample, similar to data reported in the literature.9,10 The incidence of HF increases with age, and is more frequent among men.11 The epidemic increase in HF among the older population has been associated with improved survival.12

There was no statistically significant difference in the genotype distribution between men and women in group A, which is in accordance with the study by Zhang et al.13

Current literature suggests an association of allele D with predisposition to HF,14-16 which is in disagreement with our findings. HF patients had lower blood pressure than patients with Chagas disease without systolic dysfunction (p = 0.000), which is in agreement with the study by Yang et al.17 who investigated ACE I/D genotype in a Chinese population. There were no significant differences in the frequency of alleles or genotypes between the groups in both sexes. HF patients with low blood pressure are at higher risk of death, despite adequate drug therapy.18

An independent association has been reported between DD genotype and worse echocardiographic outcomes, and between ID genotype and echocardiographic profile (increased left ventricular ejection fraction and decreased left ventricular diameters).19 These findings are in disagreement with ours, as we did not find an association between D/I genotypes and echocardiographic findings.

In our study, although we investigated a population with different characteristics, no interaction between I/D and HF was found. This is in accordance with a previous study20 including 241 patients in Saudi Arabia, in which ACE gene polymorphism was not associated with congenital heart disease.

HF is a common clinical condition with high morbidity and mortality rates. It affects 1.5-2.0% of the general population, and its prevalence increases with age, affecting approximately 10% of individuals aged over 65 years.21 These data corroborate our findings, which showed that patients with HF were significantly older than patients with Chagas disease without systolic dysfunction.

In addition, Yang et al.22 compared the distribution of I/D genotypes in 701 individuals of both sexes. No difference was found in the frequencies of genotypes and alleles in male and female between individuals aged over 90 years and a control group aged less than 60 years.

In the analysis of I/DI genotypes and LVSD, we did not find any relationship between these parameters. This is in disagreement with a national study23 reporting increased LVSD in DD genotype patients, which was associated with increased mortality and morbidity in HF patients of different etiologies.

There was a possible interaction between ACE polymorphisms in chronic HF progression.24 Allele D was associated with HF progression and higher mortality rate as compared with allele I.24,25 These data are in contrast to our results, in which I/D genotypes were not associated with HF severity.

In our study, ACE polymorphism was not associated with the severity or progression of HF secondary to Chagas disease. This is in agreement with previous studies26,27 in which ACE polymorphism was not associated with HF development or progression of Chagas cardiomyopathy.

Distribution of I/D genotypes was not different between groups A and B in our analysis. Individual genetic differences may lead to different risk profiles and small sample sizes, particularly in studies of association, with inadequate power to detect genetic contributions, which may explain the disagreement between studies.

DNA analysis tests may provide the identification of one or more genetic variants associated with increased risk for HF, and thereby contribute to preventive measures including changes in lifestyle and therapies that take into account the genetic profile.

Based on the potential use of the genetic marker in the clinical practice and the inconclusive results regarding the role of ACE polymorphism as a risk factor for the development of HF secondary to Chagas disease, this genetic marker was shown not to be useful in the clinical practice. The lack of association between I/D genotypes may indicate that ACE polymorphism does not act in the pathogenesis of ventricular dysfunction caused by Chagas disease.

 Conclusion

There was no difference in the frequencies of I/D genotypes in patients with HF secondary to Chagas disease as compared with Chagas disease patients free of systolic dysfunction. No relationship was found between ACE polymorphism and clinical outcome measures.

Study limitations

The number of patients included in the present study may be considered small as compared with the estimated number of patients with Chagas disease in our country. Socioeconomic factors may interact with genetic factors and affect HF outcomes. Our findings were obtained from public health patients, which may limit the extrapolation of the results to other populations.

Further large, prospective studies involving larger samples sizes are needed to determine which variables may be related to HF secondary to Chagas disease.

Sources of Funding

There were no external funding sources for this study.

Study Association

This article is part of the thesis of Doctoral submitted by Silene Jacinto da Silva, from Universidade Federal de Goiás.

 References 1 Carvalho G, Rassi S, Bastos JMDA, Câmara SSP. Coronariopatia assintomática em chagásicos com insuficiência cardíaca: prevalência e fatores de risco. Arq. Bras. Cardiol. 2011,97(5):408-12. Doi: org/10.1590/50066-782X2011005000.103. Carvalho G Rassi S Bastos JMDA Câmara SSP Coronariopatia assintomática em chagásicos com insuficiência cardíaca: prevalência e fatores de risco Arq. Bras. Cardiol 2011 97 5 408 412 10.1590/50066-782X2011005000.103 2 Nogueira PR, Rassi S, Corrêa KS. Perfil epidemiológico, clínico e terapêutico da insuficiência cardíaca em hospital terciário. Arq Bras Cardiol. 2010;95(3): 392-8. Doi: org/10.1590/50066-782X2010005000102. Nogueira PR Rassi S Corrêa KS Perfil epidemiológico, clínico e terapêutico da insuficiência cardíaca em hospital terciário Arq Bras Cardiol 2010 95 3 392 398 10.1590/50066-782X2010005000102 3 Silva SJ. Estudo de polimorfismos genéticos em pacientes portadores de insuficiência cardíaca. (Dissertação) Goiânia: Universidade Federal de Goiás; 2012. Silva SJ Estudo de polimorfismos genéticos em pacientes portadores de insuficiência cardíaca Dissertação Goiânia Universidade Federal de Goiás 2012 4 Carvalho APPF, Rassi S, Fontana KE, Correa KS, Feitosa RHF. Influência da suplementação de creatina na capacidade funcional de pacientes com Insuficiência Cardíaca. Arq Bras Cardiol. 2012,99(1):623-9. Doi: 10.1590/50066-782X2012005000056 Carvalho APPF Rassi S Fontana KE Correa KS Feitosa RHF Influência da suplementação de creatina na capacidade funcional de pacientes com Insuficiência Cardíaca Arq Bras Cardiol 2012 99 1 623 629 10.1590/50066-782X2012005000056 5 Bocchi EA, Marcondes-Braga FG, Bacal F, Ferraz AS, Albuquerque D, Rodrigues D. Atualização da diretriz brasileira de insuficiência cardíaca crônica - 2012. Arq Bras Cardiol. 2012,98(1Suppl1):1-33. Bocchi EA Marcondes-Braga FG Bacal F Ferraz AS Albuquerque D Rodrigues D Atualização da diretriz brasileira de insuficiência cardíaca crônica - 2012 Arq Bras Cardiol 2012 98 1 Suppl1 1 33 6 Skrzynia C, Berg JS, Willis MS, Jensen BC. Genetics and heart failure: a concise guide for the clinician. Curr Cardiol Rev. 2015,11(1):10-7.PMID:24251456. Skrzynia C Berg JS Willis MS Jensen BC Genetics and heart failure: a concise guide for the clinician Curr Cardiol Rev 2015 11 1 10 17 24251456 7 Cuoco MAR, Pereira AC, Mota GFA, Krieger JE, Mansur AJ. Polimorfismo genético, terapia farmacológica e função cardíaca sequencial em pacientes com insuficiência cardíaca. Arq. Bras. Cardiol. 2008,90(4):274-9. PMID:18516385. Cuoco MAR Pereira AC Mota GFA Krieger JE Mansur AJ Polimorfismo genético, terapia farmacológica e função cardíaca sequencial em pacientes com insuficiência cardíaca Arq. Bras. Cardiol 2008 90 4 274 279 18516385 8 Lindpaintner K, Pfeffer MA, Kreutz R, Stampfer MJ, Grodstein F, LaMotte F et al. A prospective evaluation of an angiotensin-converting-enzyme gene polymorphism and the risk of ischemic heart disease. N Engl J Med. 1995,332(11):706-11. Doi:10.1056/NEJM19950316321103. Lindpaintner K Pfeffer MA Kreutz R Stampfer MJ Grodstein F LaMotte F A prospective evaluation of an angiotensin-converting-enzyme gene polymorphism and the risk of ischemic heart disease N Engl J Med 1995 332 11 706 711 10.1056/NEJM19950316321103 9 Margoto G, Colombo RCR, Gallani MCBJ. Características clínicas e psicossociais do paciente com insuficiência cardíaca que interna por descompensação clínica. Rev Esc Enferm. 2009,43(4):44-53. PMID:19437853. Margoto G Colombo RCR Gallani MCBJ Características clínicas e psicossociais do paciente com insuficiência cardíaca que interna por descompensação clínica Rev Esc Enferm 2009 43 4 44 53 19437853 10 Silva JF, Giannini DT, Mourilhe-Rocha R. Metabolic syndrome in patients with chronic heart failure. Int J Cardiovasc Sci. 2015,28(3):206-14.Doi: 10.5935/2359-4802.20150030 Silva JF Giannini DT Mourilhe-Rocha R Metabolic syndrome in patients with chronic heart failure Int J Cardiovasc Sci 2015 28 3 206 214 10.5935/2359-4802.20150030 11 Ho KK, Pinsky JL, Kannel WB, Levy D. The epidemiology of heart failure: the Framingham Study. J Amn Coll Cardiol. 1993, 22(4 Suppl A):6A-13A. Ho KK Pinsky JL Kannel WB Levy D The epidemiology of heart failure: the Framingham Study J Amn Coll Cardiol 1993 22 4 Suppl A 6A 13A 12 Barker WH, Mullooly JP, Getchell W. Changing incidence and survival for heart failure in a well-defined older population, 1970-1974 and 1990-1994. Circulation. 2006,113(6):799-805. Doi:10.1161/CIRCULATIONAHA.104.492033 Barker WH Mullooly JP Getchell W Changing incidence and survival for heart failure in a well-defined older population, 1970-1974 and 1990-1994 Circulation 2006 113 6 799 805 10.1161/CIRCULATIONAHA.104.492033 13 Zhang YF, Cheng Q, Tang NL, Chu TT, Tomlinson B, Liu F, et al. Gender difference of serum angiotensin-converting enzyme (ACE) activity in DD genotype of ACE insertion/deletion polymorphism in elderly Chinese. Journal of the renin-angiotensin-aldosterone system: j renin Angiotensin Aldosterone Syst. 2014;15(4):547-52. Doi: 10.1177/1470320313475906. Zhang YF Cheng Q Tang NL Chu TT Tomlinson B Liu F Gender difference of serum angiotensin-converting enzyme (ACE) activity in DD genotype of ACE insertion/deletion polymorphism in elderly Chinese Journal of the renin-angiotensin-aldosterone system: j renin Angiotensin Aldosterone Syst 2014 15 4 547 552 10.1177/1470320313475906 14 Fatini C, Sticchi E, Marcucci R, Said AA, Del Pace S, Verdiani V, et al. ACE Insertion/Deletion, But Not −240A&gt;T Polymorphism, Modulates the Severity in Heart Failure. J Investig Med. 2008,56(8):1004-10.Doi: 10.2310/JIM06013-3181828028. Fatini C Sticchi E Marcucci R Said AA Del Pace S Verdiani V ACE Insertion/Deletion, But Not −240A&gt;T Polymorphism, Modulates the Severity in Heart Failure J Investig Med 2008 56 8 1004 1010 10.2310/JIM06013-3181828028 15 Schut AF, Bleumink GS, Stricker BH, Hofman A, Witteman JC, Pols HA, et al. Angiotensin converting enzyme insertion/deletion polymorphism and the risk of heart failure in hypertensive subjects. Eur Heart J. 2004,25(23):2143-8. Doi: 10.1016/j.ehj.004.08.026. Schut AF Bleumink GS Stricker BH Hofman A Witteman JC Pols HA Angiotensin converting enzyme insertion/deletion polymorphism and the risk of heart failure in hypertensive subjects Eur Heart J 2004 25 23 2143 2148 10.1016/j.ehj.004.08.026 16 Bahramali E, Rajabi M, Jamshidi J, Mousavi SM, Zarghami M, Manafi A, et al. Association of ACE gene D polymorphism with left ventricular hypertrophy in patients with diastolic heart failure: a case-control study. BMJ open. 2016,6(2):e010282. Bahramali E Rajabi M Jamshidi J Mousavi SM Zarghami M Manafi A Association of ACE gene D polymorphism with left ventricular hypertrophy in patients with diastolic heart failure: a case-control study BMJ open 2016 6 2 e010282 17 Yang YL, Mo YP, He YS, Yang F, Xu Y, Li CC, et al. Correlation between renin-angiotensin system gene polymorphisms and essential hypertension in the Chinese Yi ethnic group. Journal of the renin-angiotensin-aldosterone system: J Renin Angiotensin Aldosterone Syst.2015,16(4):975-81. Doi; 10.1177/1470320315598697. Yang YL Mo YP He YS Yang F Xu Y Li CC Correlation between renin-angiotensin system gene polymorphisms and essential hypertension in the Chinese Yi ethnic group Journal of the renin-angiotensin-aldosterone system: J Renin Angiotensin Aldosterone Syst 2015 16 4 975 981 10.1177/1470320315598697 18 Gheorghiade M, Abraham WT, Albert NM, Greenberg BH, O'Connor CM, She L, et al. Systolic blood pressure at admission, clinical characteristics, and outcomes in patients hospitalized with acute heart failure. JAMA. 2006,296(18):2217-26. Doi:1001/jama.296182217. Gheorghiade M Abraham WT Albert NM Greenberg BH O'Connor CM She L Systolic blood pressure at admission, clinical characteristics, and outcomes in patients hospitalized with acute heart failure JAMA 2006 296 18 2217 2226 1001/jama.296182217 19 Albuquerque FN, Brandao AA, Silva DA, Mourilhe-Rocha R, Duque GS, Gondar AF, et al. Angiotensin-converting enzyme genetic polymorphism: its impact on cardiac remodeling. Arq Bras Cardiol. 2014,102(1):70-9. Doi: 10.5935/abc20130229. Albuquerque FN Brandao AA Silva DA Mourilhe-Rocha R Duque GS Gondar AF Angiotensin-converting enzyme genetic polymorphism: its impact on cardiac remodeling Arq Bras Cardiol 2014 102 1 70 79 10.5935/abc20130229 20 Alazhary NM, Morsy MM, Al-Harbi KM. Angiotensin-converting enzyme gene insertion deletion (ACE I/D) polymorphism in Saudi children with congenital heart disease. Eur Rev Med Pharmacol Sci. 2015,19(11):2026-30. PMID:26125265. Alazhary NM Morsy MM Al-Harbi KM Angiotensin-converting enzyme gene insertion deletion (ACE I/D) polymorphism in Saudi children with congenital heart disease Eur Rev Med Pharmacol Sci 2015 19 11 2026 2030 26125265 21 Carvalho Filho E, Curiati J. Como diagnosticar e tratar a insuficiência cardíaca no idoso. RBM. Rev Bras Med. 2001, 58(3):14. Carvalho E Filho Curiati J Como diagnosticar e tratar a insuficiência cardíaca no idoso RBM. Rev Bras Med 2001 58 3 14 14 22 Yang JK, Gong YY, Xie L, Lian SG, Yang J, Xu LY, et al. Lack of genetic association between the angiotensin-converting enzyme gene insertion/deletion polymorphism and longevity in a Han Chinese population. Journal of the renin-angiotensin-aldosterone system: J Renin Angiotensin Aldosterone Syst. 2009,10(2):115-8. Doi: 10.1177/1470320309104873. Yang JK Gong YY Xie L Lian SG Yang J Xu LY Lack of genetic association between the angiotensin-converting enzyme gene insertion/deletion polymorphism and longevity in a Han Chinese population Journal of the renin-angiotensin-aldosterone system: J Renin Angiotensin Aldosterone Syst 2009 10 2 115 118 10.1177/1470320309104873 23 Cuoco MA, Pereira AC, de Freitas HF, de Fatima Alves da Mota G, Fukushima JT, Krieger JE, et al. Angiotensin-converting enzyme gene deletion polymorphism modulation of onset of symptoms and survival rate of patients with heart failure. Int J Cardiol. 2005,99(1):97-103. Doi:: PMID 15721506 Cuoco MA Pereira AC de Freitas HF de Fatima Alves da Mota G Fukushima JT Krieger JE Angiotensin-converting enzyme gene deletion polymorphism modulation of onset of symptoms and survival rate of patients with heart failure Int J Cardiol 2005 99 1 97 103 15721506 24 Huang W, Xie C, Zhou H, Yang T, Sun M. Association of the angiotensin-converting enzyme gene polymorphism with chronic heart failure in Chinese Han patients. Eur J Heart Fail. 2004,6(1):23-7. Doi; 10.1016/j.ejheart.2003.09.004 Huang W Xie C Zhou H Yang T Sun M Association of the angiotensin-converting enzyme gene polymorphism with chronic heart failure in Chinese Han patients Eur J Heart Fail 2004 6 1 23 27 10.1016/j.ejheart.2003.09.004 25 Wu CK, Luo JL, Tsai CT, Huang YT, Cheng CL, Lee JK, et al. Demonstrating the pharmacogenetic effects of angiotensin-converting enzyme inhibitors on long-term prognosis of diastolic heart failure. Pharmacogenomics J. 2010, 10(1):46-53. Doi: 10.1038/fpj.2009.39. Wu CK Luo JL Tsai CT Huang YT Cheng CL Lee JK Demonstrating the pharmacogenetic effects of angiotensin-converting enzyme inhibitors on long-term prognosis of diastolic heart failure Pharmacogenomics J 2010 10 1 46 53 10.1038/fpj.2009.39 26 Pascuzzo-Lima C, Mendible JC, Bonfante-Cabarcas R. Polimorfismo I/D del gen de la enzima de conversión de angiotensina y progresión de la miocardiopatía chagásica. Rev Esp Cardiol. 2009, 62(03):320-2. Doi:10.1016/S0300-8932(09)70379-3 Pascuzzo-Lima C Mendible JC Bonfante-Cabarcas R Polimorfismo I/D del gen de la enzima de conversión de angiotensina y progresión de la miocardiopatía chagásica Rev Esp Cardiol 2009 62 03 320 322 10.1016/S0300-8932(09)70379-3 27 Silva S, Rassi S, Silva C. Ausência de associação do polimorfismo dos alelos D/I do gene da enzima conversora de angiotensina (ECA) em pacientes com insuficiência cardíaca. RBM. Rev Bras Med. 2015,72(4):130-5. Silva S Rassi S Silva C Ausência de associação do polimorfismo dos alelos D/I do gene da enzima conversora de angiotensina (ECA) em pacientes com insuficiência cardíaca RBM. Rev Bras Med 2015 72 4 130 135 Artigos Polimorfismo da Enzima Conversora da Angiotensina (ECA D/I) em Pacientes com Insuficiência Cardíaca de Etiologia Chagásica Silva Silene Jacinto da 1 Rassi Salvador 1 Pereira Alexandre da Costa 2 Ciências da Saúde - Faculdade de Medicina - Universidade Federal de Goiás, Goiânia, GO – Brasil Instituto do Coração (Incor) do Hospital das Clínicas da Faculdade de Medicina da Universidade de São Paulo (HCFMUSP), São Paulo, SP - Brasil Correspondência: Silene Jacinto da Silva. Av. Joaão Rita Dias, Q 105 LT 06. CEP 74455-360, Jardim Leblon, Goiânia, GO - Brasil. E-mail: silenejacintoa@gmail.com

Contribuição dos autores

Concepção e desenho da pesquisa, obtenção de dados e análise estatística: Silva SJ; Análise e interpretação dos dados e redação do manuscrito: Silva SJ, Rassi S, Pereira AC; Obtenção de financiamento: Silva SJ, Pereira AC; Revisão crítica do manuscrito quanto ao conteúdo intelectual importante: Rassi S, Pereira AC.

Potencial conflito de interesses

Declaro não haver conflito de interesses pertinentes.

 Resumo Fundamento:

Alterações no gene da Enzima Conversora de Angiotensina (ECA) podem contribuir para o aumento da pressão arterial e consequentemente para o surgimento de insuficiência cardíaca (IC). O papel do polimorfismo ainda é bastante controverso, sendo necessária sua identificação em pacientes com IC de etiologia chagásica na população brasileira.

 Objetivo:

Determinar o polimorfismo da ECA em portadores de IC com etiologia chagásica e pacientes com doença de Chagas sem disfunção sistólica, e avaliar a relação do polimorfismo ECA com diferentes variáveis clínicas.

 Métodos:

Trata-se um estudo clínico comparativo com 193 participantes, destes, 103 com IC de etiologia chagásica e 90 pacientes com doença de Chagas sem disfunção sistólica, todos em atendimento ambulatorial no Hospital das Clínicas da Universidade Federal de Goiás. Os alelos D e I do polimorfismo da ECA foram identificados por reação em cadeia da polimerase dos respectivos fragmentos provenientes do íntron 16 no gene da ECA e visualizados em eletroforese.

 Resultados:

Dos portadores de IC, 63 % eram do gênero masculino, enquanto nos portadores de doença de Chagas sem disfunção sistólica 53,6% eram do gênero feminino (p = 0,001). O tempo de diagnóstico variou de 1 a 50 anos. A distribuição dos genótipos DD, DI e II foi semelhante entre os dois grupos, não apresentando significância estatística (p = 0,692). Nenhuma interação foi observada em relação às características clínicas e os genótipos D/I entre os grupos. A idade foi significativamente diferente entre os grupos (p = 0,001), e a média de idade dos pacientes com IC foi de 62,5 anos.

 Conclusão:

Não foram observadas diferenças na distribuição das frequências dos genótipos (Deleção/Inserção) do polimorfismo ECA entre os grupos estudados. A utilização deste biomarcador genético não se mostrou útil na tentativa de se conhecer a existência da relação do polimorfismo ECA e as manifestações clínicas da IC de etiologia chagásica.

 Palavras-chave: Doença de Chagas Polimorfismo Genético Insuficiência Cardíaca Cardiomiopatia Chagásica Introdução

A doença de Chagas apresenta características endêmicas e constitui importante causa de cardiomiopatia dilatada e insuficiência cardíaca (IC) em regiões de baixas condições socioeconômicas, acarretando elevados índices de morbimortalidade. O diagnóstico e tratamento precoce são medidas importantes para a melhora da sobrevida e da qualidade de vida.1

Na região centro-oeste, estudos2-4 mostraram que a doença de Chagas foi considerada a principal causa de IC. É a primeira causa de IC em áreas endêmicas, e a terceira causa no Brasil. A morte súbita cardíaca acomete aproximadamente 50% dos pacientes com IC secundária à doença de Chagas.5

A maioria dos problemas de saúde humana, incluindo a IC tem etiologia multifatorial, influenciada pelo meio ambiente, estilo de vida, e fatores genéticos. Os distúrbios multifatoriais são caracterizados por contribuições fenotípicas de vários genes que interagem uns com os outros e com os fatores ambientais. Muitos distúrbios que são manifestados no indivíduo adulto são caracterizados por herança autossômica dominante, incluindo as formas hereditárias de cardiomiopatia.6

O gene da enzima conversora da angiotensina (ECA) (21 kb) está localizado no cromossomo 17, braço longo (q), região 23 e se caracteriza por apresentar 24 íntrons.7 Predizer a resposta individual ao tratamento e os riscos potenciais de efeitos adversos aos medicamentos é uma aspiração para o tratamento da IC. Com o crescimento da biologia molecular e das informações genéticas, gradualmente há a necessidade de uma redefinição das doenças baseada nos processos bioquímicos que as compõe e não no fenótipo com que elas apresentam. O conhecimento e tratamento das doenças cardíacas, o isolamento e a caracterização dos genes envolvidos poderão não constituir uma panaceia, mas sim um ponto de partida para o tratamento individualizado.

Neste contexto, o presente estudo teve como objetivo verificar a distribuição do polimorfismo ECA (D/I) em portadores de IC de etiologia chagásica, comparar essa distribuição com a de portadores da doença de Chagas sem disfunção sistólica, e avaliar sua relação com algumas variáveis clínicas.

Aspectos Éticos

O estudo foi analisado e aprovado pelo Comitê de Ética em Pesquisa do Hospital das Clínicas da Universidade Federal de Goiás, número do parecer: 908.870 em 16 de Dezembro de 2014.

 Delineamento do estudo

Trata-se de um estudo clínico comparativo realizado em dois grupos de pacientes (grupo A e grupo B) provenientes dos Ambulatórios de Cardiologia e Ambulatório de Chagas do Hospital das Clínicas (HC/UFG). O período de admissão dos pacientes no estudo foi de fevereiro de 2014 a outubro de 2015.

 Pacientes

Foram selecionados de forma consecutiva 193 pacientes. Sendo 103 pertencentes ao grupo A (portadores de IC de etiologia chagásica) e 90 pertencentes ao grupo B (portadores de doença de Chagas sem disfunção sistólica). Todos pacientes encontravam-se em acompanhamento ambulatorial.

 Critérios de inclusão

Grupo A: Pacientes com IC sintomática (pelos critérios de Framingham) de etiologia chagásica. Grupo B: Pacientes com diagnóstico de doença de Chagas sem disfunção sistólica.

 Critérios de exclusão

Disfunção cardíaca no grupo B que levou à exclusão dos indivíduos deste estudo.

 Parâmetros clínicos e laboratoriais

Todos os dados clínicos foram extraídos do prontuário médico. Para expressar o status clínico atual do paciente, foram considerados exames laboratoriais, e resultados de eletrocardiograma e ecodopplercardiograma mais recentes disponíveis.

Nos pacientes com IC, a classe funcional foi determinada de acordo com a New York Heart Association, de acordo com a equipe médica ambulatorial. Para os exames de ecodopplercardiograma foram analisados os seguintes parâmetros: Átrio Esquerdo (AE), Diâmetro Sistólico de Ventrículo Esquerdo (DSVE), Diâmetro Diastólico de Ventrículo Esquerdo (DDVE) e Fração de Ejeção de Ventrículo Esquerdo (FEVE).

 Genotipagem

Foram coletados amostras de 8 mL de sangue e armazenados em dois tubos contendo EDTA como anticoagulante. Posteriormente, foi realizada a extração de DNA, seguido da genotipagem para o polimorfismo ECA pela Reação em Cadeia da Polimerase (PCR), classificada em D/D (Deleção/Deleção), D/I (Deleção/Inserção) ou I/I (Inserção/Inserção).

O método de genotipagem foi adaptado de Lindpaintner et al.,8 para um volume final de 25 µL foram adicionados 1 mM de primers, 200 mM de desoxinucleotídeos trifosfatados (dATP, dCTP, dGTP, dTTP), 1,3 mM de cloreto de magnésio, 50 mM de cloreto de potássio, 0,5 unidade de Taq DNA polimerase e 20 ng de DNA. Os primers sense GCCCTGCAGGTGTCTGCAGCATGT e antisense GGATGGCTCTCCCCGCCTTGTCTC foram usados para amplificar os alelos D e I, resultando em amplicons de 319pb e 597pb respectivamente. O protocolo de amplificação do DNA constituiu-se por uma desnaturação inicial de 94°C por 5 minutos, seguido de 35 ciclos, sendo 30 segundos a 94°C, 45 segundos a 56°C, 2 minutos a 72°C, e 7 minutos a 72°C. O produto da amplificação dos alelos D e I foram submetidos à eletroforese em gel de agarose 1,5% e corados com brometo de etídio a 0,5 mg/mL por 10 minutos. Devido a amplificação preferencial do alelo D em heterozigose, as amostras com o genótipo DD foram reamplificadas com primers TGGGACCACAGCCGCGCCTACCAC e TCGGCCCTCCCACCACCATGCTAA sense e antisense respectivamente, em idênticas condições de PCR, com exceção da temperatura de anelamento à 67°C. A avaliação dos produtos de PCR em gel de agarose a 1,5% revelaram um amplicon de 335 pb na presença de um alelo I. Os resultados foram capturados pelo sistema de vídeo-documentação Image Master VDS® (Pharmacia Biotech, EUA).

 Análise estatística

A estatística descritiva foi utilizada para caracterização das variáveis - as variáveis categóricas foram descritas em percentuais, as variáveis contínuas com distribuição normal em médias ± desvios-padrão, e as variáveis contínuas de distribuição não normal em mediana e intervalos interquartis. O teste de Kolmogorov-Smirnov Z foi utilizado para identificar as variáveis contínuas com distribuição normal. Diferenças entre os grupos A e B foram calculadas utilizando o teste de qui-quadrado ou teste t de Student não pareado e, quando apropriado, o teste de Man-Whitney. A medida de associação entre as variáveis de exposição à IC foi o Odds Ratio (OR), com respectivos intervalos de 95% de confiança. Variáveis foram consideradas estatisticamente diferentes entre os grupos quando os valores de p foram menores que 0,05. Os resultados foram analisados por meio do programa estatístico SPSS, versão 18.0.

 Resultados

Foi observada diferença significativa na distribuição de gêneros entre os grupos (p = 0,023), com 63% dos pacientes com IC do gênero masculino.

A média de idade dos pacientes com IC foi de 62,5 ± 11,1 anos, apresentando diferença significativa entre os grupos (p = 0,00). As características sociodemográficas e clínicas da amostra encontram-se na Tabela 1.

Características sociodemográficas e clínicas da amostra
Variáveis Grupo A Grupo B OR IC95% Valor de p
n % n %
Gênero
Masculino 51 63,0 30 37,0 1,96 1,09-3,52 0,023a
Feminino 52 46,4 60 53,6
Média de idade (DP) 62,5 (11,1) 51,3 (11,9) 0,000b
Procedência
Goiânia 59 54,6 49 45,4 1,12 0,64-1,98 0,692a
Outras localidades 44 51,8 41 48,2
Mediana do tempo de diagnóstico da doença de Chagas (intervalo inter-quartil) 15 (8-25) 9,5 (5-17) 0,002c
Tabagismo
Sim 30 73,2 11 26,8 2,95 1,38-6,32 0,004a
Não 73 48,0 79 52,0
Etilismo
Sim 21 42,0 29 58,0 0,34 0,28-1,03 0,061a
Não 82 57,3 61 42,7
Mediana da FC (bpm)(intervalo inter-quartil) 65 (60-80) 65 (60-80) 0,290c
Megaesôfago
Sim 18 38,3 29 61,7 0,45 0,23-0,87 0,017a
Não 85 58,2 61 41,8
Megacólon
Sim 9 64,3 5 35,7 1,63 0,53-5,05 0,395a
Não 94 52,5 85 47,5
Dislipidemia
Sim 15 75,0 5 25,0 2,90 1,01-8,32 0,041a
Não 88 50,9 85 49,1
Diabetes mellitus
Sim 6 54,5 5 45,5 1,05 0,31-3,57 0,936a
Não 97 53,3 85 46,7

DP: desvio padrão; FC: frequência cardíaca; Grupo A: pacientes com insuficiência cardíaca de etiologia chagásica; Grupo B: pacientes com doença de Chagas sem disfunção sistólica; bpm: batimentos por minuto; OR: odds ratio.

teste do qui-quadrado;

teste t de Student não pareado;

Teste de Mann Whitney.

Todos os pacientes com IC estavam em tratamento medicamentoso, 73,2% era tabagista, esse hábito foi estatisticamente significativo entre os grupos (p = 0,004). Em relação às comorbidades associadas à IC, houve predomínio de dislipidemia (75%). A média da frequência cardíaca foi maior nos pacientes com IC (p = 0,030) em comparação ao grupo B.

A presença de megaesôfago foi prevalente apenas no grupo B (61,7%), com diferença estatisticamente significativa entre os grupos (p = 0,017). O tempo decorrido desde o diagnóstico da doença de Chagas foi estatisticamente diferente entre os grupos (p = 0,001).

Perfil genético da população estudada

A fim de estabelecer a prevalência dos genótipos para o polimorfismo ECA entre os pacientes do grupo A e grupo B, foram analisados a frequência dos genótipos DD, DI e II (Tabela 2). Não houve diferença estatisticamente significativa nas frequências observadas dos genótipos em relação às esperadas entre os grupos (p = 0,692).

Polimorfismo D/I nos grupos A e B
Genótipo Grupo A Grupo B Valor de p
N % N %
DD 17 50,0 17 50,0 0,692a
DI 59 56,2 46 43,8
II 27 50,0 27 50,0

DD: deleção/deleção; DI: deleção/inserção; II: inserção/inserção; grupo A: pacientes com insuficiência cardíaca de etiologia chagásica; Grupo B: pacientes com doença de Chagas sem disfunção sistólica.

teste do qui-quadrado;

As médias dos valores das variáveis ecocardiográficas e os genótipos não foram estatisticamente diferentes entre os grupos. Os portadores do genótipo DI apresentaram média mais elevada nos valores do DDVE quando comparado a outros genótipos.

Para as medidas repetidas de dados categóricos, não houve variação significativa na classe funcional e nos genótipos D/I (p = 0,472) entre os grupos. Apenas quatro pacientes encontravam-se em classe funcional IV, a classe funcional II foi predominante na amostra, presente em 86 pacientes. Destes, 52,3% eram pertencentes ao genótipo DI.

No grupo B os pacientes apresentaram megaesôfago, porém não houve diferença no número de pacientes com e sem megaesôfago. A dislipidemia foi associada como um risco aumentado em 5 vezes para os portadores de IC. Os genótipos DD, DI e II não foram considerados como um fator de risco para IC, pois sua distribuição não foi estatisticamente diferente entre os grupos.

 Discussão

A literatura é repleta de resultados conflitantes, permanecendo intenso o debate sobre a existência de quais seriam os polimorfismos implicados na susceptibilidade para o desenvolvimento ou agravamento da IC. No presente estudo, foi avaliado o papel do polimorfismo genético do gene ECA (D/I) em pacientes com IC de etiologia chagásica e pacientes portadores de doença de Chagas sem disfunção sistólica. Nesta população, não se encontrou associação do polimorfismo ECA com as características sociodemográficas e clínicas.

O gênero masculino foi predominante (63%) em nossa amostra, assim como em dados presente na literatura.9,10 A incidência de IC aumenta com a idade, sendo mais frequente em homens.11 O aumento da epidemia de IC na população masculina e idosa foi associado com maior sobrevida.12

Não houve diferença estatisticamente significativa na distribuição dos genótipos entre gênero masculino e feminino no grupo A, dado concordante com o estudo de Zhang et al.13

Dados presentes na literatura associaram o alelo D com a predisposição para HÁ.14-16 Estes dados contradizem os nossos achados. Os portadores de IC apresentaram valores de pressão arterial inferior ao grupo com doença de Chagas sem disfunção sistólica (p = 0,000), assim como nos resultados encontrados por Yang et al.,17 que investigaram os genótipos D/I em indivíduos de etnia chinesa. Não houve diferenças significativas na frequência dos alelos e genótipos entre os grupos de indivíduos em ambos os gêneros. Pacientes com IC e pressão arterial baixa tem maior risco de morte, mesmo com uso adequado de terapias farmacológicas.18

O genótipo DD foi associado de forma independente à pior evolução ecocardiográfica e o genótipo DI ao melhor perfil ecocardiográfico (aumento da fração de ejeção do VE e diminuição de diâmetros do VE).19 Nossos resultados são discordantes, pois, não foi verificado associação dos genótipos D/I com os parâmetros ecocardiográficos.

Mesmo pesquisando uma população com características diferentes, não encontramos nenhuma interação dos genótipos D/I com a IC. O mesmo achado já havia sido demonstrado em estudo20 que avaliou 241pacientes provenientes da Arábia Saudita. Após a realização da genotipagem para o polimorfismo do gene ECA não foi encontrada interação com a cardiopatia congênita.

A IC é uma condição clínica frequente que apresenta elevado grau de morbidade e mortalidade. Ela acomete 1,5% a 2,0% da população geral, porém sua prevalência aumenta progressivamente com a idade, atingindo aproximadamente 10% dos indivíduos com mais de 65 anos de idade.21 Esses dados confirmam nossos resultados, em que os pacientes com IC apresentaram idade significativamente superior aos pacientes com doença de Chagas sem disfunção sistólica.

Corroborando com nossos achados, Yang et al.,22 compararam a distribuição dos genótipos D/I em uma população de 701 indivíduos de ambos os gêneros. Nenhuma diferença foi encontrada na frequência dos genótipos e alelos em homens e mulheres entre um grupo de indivíduos com idade superior a 90 anos e um grupo controle com idade inferior a 60 anos.

Na análise dos genótipos D/I e do DSVE, não foi encontrada relação entre esses parâmetros. Nossos achados são discordantes de um estudo nacional23 em que encontraram aumento do DSVE em pacientes com o genótipo DD, associando-se com maior morbidade e mortalidade em pacientes com IC de diferentes etiologias.

Há uma possível interação do polimorfismo ECA na progressão da IC crônica.24 O alelo D foi associado com a progressão da IC e maior mortalidade quando comparado com o alelo I.24,25 Esses dados opõem-se aos resultados encontrados neste estudo, o qual os genótipos D/I não foram associados com a gravidade da IC.

O polimorfismo ECA não foi associado com a gravidade ou progressão da IC de etiologia chagásica. Corroborando com nossos dados, estudos anteriores26,27 não associaram o polimorfismo da ECA com desenvolvimento da IC ou progressão da cardiomiopatia chagásica.

Em nossa análise, a distribuição dos genótipos D/I foi semelhante entre os grupos A e B. Diferenças genéticas individuais podem levar a diversos perfis de riscos e número amostral pequeno, especialmente em estudos de associação, com poder inadequado para identificar contribuições genéticas, o que pode justificar uma discordância com os resultados encontrados.

Testes de análise do DNA podem fornecem a identificação de uma ou mais variantes genéticas associadas ao risco maior de IC e, assim, contribuir para medidas preventivas de mudanças de hábitos de vida e terapias que levem em conta o seu perfil genético.

Baseando-se no potencial de aplicabilidade do marcador genético na prática clínica e dos resultados inconclusivos acerca do papel do polimorfismo da ECA como fator de risco para o desenvolvimento da IC de etiologia chagásica, o uso desse marcador genético não foi útil para ser incorporado à prática clínica. A falta de associação entre os genótipos D/I pode indicar que o polimorfismo ECA não atua na patogênese da disfunção ventricular causada pela doença de Chagas.

 Conclusão

Não houve diferença na frequência dos genótipos D/I nos pacientes portadores de IC de etiologia chagásica, quando comparados com os pacientes portadores e doença de Chagas sem disfunção sistólica. Não houve relação entre o polimorfismo ECA e as variáveis clínicas analisadas.

Limitações do estudo

O número de pacientes incluídos pode ser considerado pequeno se comparado ao valor estimado de portadores da doença existentes em nosso país. Aspectos socioeconômicos podem interagir com fatores genéticos e interferir nos desfechos da IC. Os achados neste estudo, em que apenas pacientes da rede pública foram estudados, podem impedir que os dados sejam reproduzidos em outras populações.

Serão necessários novos estudos, amplos e prospectivos com um grupo amostral maior, capazes de apontar estas e outras variáveis potencialmente relacionadas à IC de etiologia exclusivamente chagásica.

Fontes de financiamento

O presente estudo não teve fontes de financiamento externas.

Vinculação acadêmica

Este artigo é parte de tese de Doutorado de Silene Jacinto da Silva pela Universidade Federal de Goiás. de risco para IC, pois sua distribuição não foi estatisticamente diferente entre os grupos.