Arq Bras CardiolabcArquivos Brasileiros de CardiologiaArq. Bras. Cardiol.0066-782X1678-4170Sociedade Brasileira de Cardiologia - SBCDDPtc48YfwyGmGD5zKmCJsyS0066-782X2016004100147S0066-782X201600501910210.5935/abc.20160099Original ArticleEffect of Fetal Hypothyroidism on Cardiac Myosin Heavy Chain Expression in Male RatsYousefzadehNasibeh1JeddiSajad2AlipourMohammad Reza1Tabriz University of Medical SciencesDrug Applied Research CenterTabrizIranDrug Applied Research Center, Tabriz University of Medical Sciences, Tabriz, IranTabriz University of Medical SciencesShahid Beheshti University of Medical SciencesTehranIranEndocrine Physiology Research Center, Research Institute for Endocrine Sciences, Shahid Beheshti University of Medical Sciences, Tehran - IranShahid Beheshti University of Medical SciencesMailing Address: Mohammad Reza Alipour, Drug Applied Research Center, Tabriz University of Medical Sciences. Postal Codo 5166614766, Tabriz - Iran. E-mail: alipourmr@tbzmed.ac.ir, alipourmr52@gmail.com
Author contributions
Conception and design of the research, Acquisition of data, Analysis and interpretation of the data and Writing of the manuscript: Jeddi S, Yousefzadeh N, Alipour MR; Statistical analysis: Yousefzadeh N, Alipour MR; Obtaining financing and Critical revision of the manuscript for intellectual content: Alipour MR.
Potential Conflict of Interest
No potential conflict of interest relevant to this article was reported.
11720160820161072147153171220152501201505052016This is an Open Access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.AbstractBackground:
Thyroid hormone deficiency during fetal life could affect the cardiac function in later life. The mechanism underlying this action in fetal hypothyroidism (FH) in rats has not been elucidated thus far.
Objective:
The aim of this study is to evaluation the effect of FH on cardiac function in male rats and to determine the contribution of α-myosin heavy chain (MHC) and β-MHC isoforms.
Methods:
Six pregnant female rats were randomly divided into two groups: The hypothyroid group received water containing 6-propyl-2-thiouracil during gestation and the controls consumed tap water. The offspring of the rats were tested in adulthood. Hearts from the FH and control rats were isolated and perfused with langendroff setup for measuring hemodynamic parameters; also, the heart mRNA expressions of α- MHC and β-MHC were measured by qPCR.
Results:
Baseline LVDP (74.0 ± 3.1 vs. 92.5 ± 3.2 mmHg, p < 0.05) and heart rate (217 ± 11 vs. 273 ± 6 beat/min, p < 0.05) were lower in the FH rats than controls. Also, these results showed the same significance in ±dp/dt. In the FH rats, β-MHC expression was higher (201%) and α- MHC expression was lower (47%) than control.
Conclusion:
Thyroid hormone deficiency during fetal life could attenuate normal cardiac functions in adult rats, an effect at least in part due to the increased expression of β-MHC to α- MHC ratio in the heart.
Previous studies have shown that several of the diseases taking place in adulthood such as diabetes, hyperlipidaemia, and cardiovascular diseases are the result of intrauterine growth restriction (IUGR).1 IUGR can result from a number of causes including malnutrition, stress, and endocrine disorder such as thyroid abnormality.2,3
Thyroid hormones have an important role in the development and growth of various organs during life, especially in fetal and neonatal periods.4 It has been reported that decrease of thyroid hormones levels during fetal life (fetal hypothyroidism) in rats causes IUGR and induces cardiac dysfunction in the later life of the offspring;5,6 however, the underlying mechanisms have not been elucidated yet.
Myosin heavy chain (MHC) is the major contractile protein of the heart tissue and primary regulator of cardiac function and contractility, which represents two MHC isoforms: α-MHC and β-MHC.7,8 The proportion of α-MHC and β-MHC isoforms may differ according to development stage, and changes in this ratio hinder cardiac contractility7. Increased expression of heart β-MHC, a common feature of heart failure, can be induced by mechanical stress and hypothyroidism.9,10
To the best of our knowledge, there is no documented report addressing the mechanism of heart failure in fetal hypothyroidism (FH) rats; the aim of this study is therefore to determine whether changes in the expressions of α-MHC and β-MHC genes are involved in cardiac dysfunction in fetal hypothyroidism rats.
MethodsAnimals
Male and female Wistar rats were housed in an animal room with a temperature of 22 ± 3°C, relative humidity of 50 ± 6%, and had free access to standard rat chow and tap water during the study. The animals were adapted to an inverse 12:12 h light/dark cycle. All experimental procedures employed, as well as rat care and handling, were in accordance with guidelines provided by the local ethics committee.
Fetal hypothyroidism induction
Six virgin female Wistar rats (body weight = 200 ± 10 g) were housed overnight with male rats (body weight = 300 ± 20 g) (two female and one male rat per cage) in the proestrus phase determined by vaginal smears for mating. The pregnant females were randomly divided into: 1 - The 0.025% 6-propyl-2-thiouracil (PTU)-consuming during pregnancy and 2-The control mother groups. After this division, they were then transferred to separate cages. The PTU-consuming mothers received PTU in drinking water during pregnancy (initiated on day 1 of pregnancy and discontinued after delivery) and the control mothers received only tap water. After weaning, the male offspring of the mothers were separated and divided into 2 as follows: FH (n = 8) and controls (n = 8), and were housed in groups of four per cage with free access to food and water. In this study, the rats in the control and FH groups were divided into two subgroups and, then, the functional study and molecular analysis were performed. After the birth, the weight of the offspring in all the groups was measured monthly from the first day of birth until the end of the month 3. In addition, weight gain until 3 months of age was measured in the control and FH groups.
Total T3 and T4 measurements
To assess the thyroid function status, the blood samples were obtained - from the mothers after delivery and the from offspring at birth and 3 months old - centrifuged (3000 × g, 10 min at 4°C), and the sera were stored at -80°C until the time of assay. Total triiodothyronine (TT3) and total thyroxine (TT4) levels were measured by ELISA kits (Pishtazteb Company, Iran). Intra- and inter-assay coefficients of variations were 3.6 and 4.7% for T3 and 5.8 and 6.3% for T4, respectively.
Measurement of hemodynamic parameters
All the rats at 3 months of age were anesthetized by the intra-peritoneal injection of ketamine and xylazine (60 mg/kg and 10 mg/kg). The hearts of the control and FH rats were rapidly excised and immersed in an ice-cold perfusion buffer; aortas were then cannulated and the hearts were fixed on the constant-pressure mode of the Langendorff perfusion apparatus and perfused through the aorta with a Krebs-Henseleit solution (pH = 7.4) containing (mmol/L): NaCl 118, NaHCO3 25, KCl 4.7, MgCl2 1.2, CaCl2 2.5, KH2PO4 1.2, and glucose 11; perfusion pressure of the solution was adjusted constantly at 75 mmHg and Krebs solution was gassed with the mixture of 95% O2 and 5% CO2 at 37°C.
A latex balloon was inserted in the left ventricle to allow for the measurement of the left ventricular developed pressure (LVDP), peak rates of positive (+dP/dt) and negative (-dp/dt), changes in the left ventricular pressure, and heart rate (HR). Hemodynamic parameters (HR, LVDP, and ±dp/dt) were digitalized by a Power Lab (AD instrument, Australia) system.11
RNA isolation, cDNA synthesis and Real-time quantitative PCR
Total RNA was extracted from the left ventricle of hearts using RNX-Plus solution kit (Fermentase, Cinagen Co. Iran) in accordance to the manufacturer's instructions. RNA quantity and purity were measured using the NanoDrop 1000 (Thermo Scientific, Waltham, and Mass). The α-MHC and β-MHC genes expression were quan titatively assessed by real-time polymerase chain reaction, primers' sequences for each gene were chosen using Gene-Runner Software, version 3.05 (Table 1). For synthesis of cDNA, total RNA was reverse transcribed by means of Revert Aid M-MuLV reverse transcriptase, dNTPS, random hexamer primers, DNase I, and RiboLock RNase-inhibitor, for 10 min at 25°C, followed by 60 min at 42°C in a final volume of 20 µl. The reaction was terminated by heating at 70°C for 5 min.
The primers sequences
Genes
Primers Sequencea
α-MHC
F: GCTGGAGCTGATGCACCTGT
R: TCGGCATCTGCCAGGTTGTC
β-MHC
F: TCGGGAAGCAGTGCCAGAAC
R:AGGAGCAGGAAGGGTCGGTT
β-actin
F: TACAGCTTCACCACCACAGC
R: ATGCCACAGGATTCCATACC
Sequences were derived from NCBI (www.ncbi.nlm.nih.gov).
A master mix containing 12.5 µl SYBR Green PCR Master Mix (Fermentase, Germany), 8.5 µl water and 2 µl forward primer and reverse primer in a final volume of 25 µl was prepared to carry out real-time PCR. Two microliters of reverse transcribed cDNA were then added to the PCR master mix to achieve a final volume of 25 µl. Reactions with no template were included as negative controls.
The PCR protocol was used on the real-time PCR machine (Rotor-Gene 3000) in three steps including: 1 - initial denaturation (10 min at 95°C); 2 - a three-step amplification program (15 s at 95°C followed by 30 s at 60°C for α-MHC and β-MHC genes; and 30s at 72°C) repeated 40 times; and step 3-melting curve analysis (1 cycle: 72 to 95°C with temperature transition rate 1°C/sec for 5 sec). Real-time quantification was monitored by measuring the increase in fluorescence caused by binding of the SYBR Green dye to double-stranded DNA at the end of each amplification cycle. All runs were performed in duplicates. The relative amount of mRNA for each target gene was calculated based on its threshold cycle (Ct) compared to the Ct of the house keeping (reference) gene (β-actin). The relative quantification was performed by 2(-)(∆ )(∆ Ct) method as follows:12
2-[(Ct target gene - Ct reference gene) experimental - (Ct target gene -Ct reference gene) Control]. The specificity of the PCR reactions was verified by generation of a melting curve analysis.
Statistical analysis
All the values were expressed as means ± SEM. The statistical analysis was performed using SPSS software (SPSS, Chicago, IL, USA; version 20). Shapiro-Wilk test was used to check the normality of the studied data and, then, parametric or non-parametric tests were used for the analysis of normal or non-normal data distribution, respectively.13 Therefore, the Student's sample t-test was used to compare thyroid hormone levels, LVDP, HR, ± dp/dt, and body weight between the groups. Mann-Whitney U test was also used for comparing gene expression between the two groups. Two-sided p values of < 0.05 were considered statistically significant.
Results
Effects of PTU administration on thyroid hormone levels during pregnancy (total T4 and T3), in serum from the mothers are shown in Figure 1A. As shown, the mothers which consumed PTU during pregnancy had lower total T4 and T3 in serum compared with the control group (p < 0.05).
Serum T 3 and T 4 concentrations in mother (A), neonate (B) and 3 month of age (C) in the fetal hypothyroid, and control rats. Values are mean ± SEM. *p < 0.05, statistically significant differences between hypothyroid and control in mothers and fetal hypothyroid and control rats in offspring. (n = 8 rats). T<sub>4</sub>: Thyroxine; T<sub>3</sub>: triiodothyronine; FH: Fetal hypothyroidism.
Total T4 and T3 in serum from the offspring after the administration of PTU in pregnant mothers are shown in Figure 1B and 1C. The offspring at birth had lower total T4 and T3 in serum compared with the control group (p < 0.05) (Figure 1 B), whereas in adulthood (month 3), there was no significant difference between the two groups (Figure 1C).
Figure 2 shows the effects of thyroid hormone deficiency during fetal life on body weight in the offspring (at birth until 3 months of age). As shown, body weight at birth was significantly lower in the FH rats than the controls. In addition, weight gain until 3 months of age was significantly less in the FH rats compared with the controls.
Body weight in the fetal hypothyroid and control rats. Values are mean ± SEM. *p < 0.05, statistically significant differences between fetal hypothyroid and control rats. (n = 8 rat). FH: Fetal hypothyroidism.
Hemodynamic parameters including LVDP, ±dp/dt and heart rate in the offspring (at 3 months of age) which had thyroid hormone deficiency during fetal life are demonstrated in Figure 3. The baseline level of LVDP in the FH rats was significantly lower than that of the controls (Figure 3A) (p < 0.05). In addition, the FH rats had lower baseline levels of the heart rate and +dp/dt and -dp/dt than the controls (Figures 3B, 3C and 3D, respectively) (p < 0.05).
Hemodynamic parameters in the fetal hypothyroid and control rats. A) Left ventricular developed pressure (LVDP); B) Heart rate; C) Peak rates of positive changes in left ventricular pressure (+dp/dt); D) Peak rates of negative changes in left ventricular pressure (-dp/dt); Values are mean ± SEM; (n = 8 rats); *p < 0.05, statistically significant differences between fetal hypothyroid and control rats. FH: Fetal hypothyroidism.
Effects of thyroid hormone deficiency during fetal life on the expression of β- and α-MHC expressions in the offspring with 3 months of age are shown in Figure 4. In the FH rats, β-MHC expression was higher (201%) (Figure 4A) (p < 0.05) and α- MHC expression was lower (47%) compared with control rats (Figure 4B) (p < 0.05).
Gene expression in hearts of the fetal hypothyroid and control rats. MHC; (myosin heavy chain) *p < 0.05. Data were normalized to the calibrator (set to 1) and presented as mean ± SEM. FH: Fetal hypothyroidism.
Discussion
Our results showed that thyroid hormones deficiency in fetal life could attenuate the normal cardiac functions including LVDP, HR, and ±dp/dt during adulthood. Cardiac dysfunction in FH rats is, at least in part, due to increased β-MHC expression and decreased α-MHC expression.
In this study, the FH rats had less weight gain until month 3 of age, a result in line with previous studies.6,13 Previous reports have shown that low birth weight is a risk factor for later diseases in adulthood in humans and animals, including cardiovascular diseases.2,14-15
Previous reports have also demonstrated that the cardiovascular functions can be affected by IUGR.5 In the present study, PTU consumption during the pregnancy period in mothers induced IUGR in the offspring. It has been reported that thyroid hormones deficiency in fetal life causes IUGR.6 Results from this study demonstrated that hypothyroid mothers at the time of delivery and their offspring at birth had lower thyroid hormones levels (total T3 and T4 levels) compared with the corresponding controls. However, the levels of these hormones in the adult offspring were normal, indicating that the FH rats had thyroid hormones deficiency only during the fetal period. Previous studies have indicated that thyroid hormones are necessary for the development and normal cardiac function during life, especially fetal life.6,16
In this study, the FH rats had lower baseline level of LVDP, ±dp/dt, and heart rate compared to controls. Decreases observed in LVDP, ±dp/dt, and also in the heart rate in this study were similar to those of the previous reports,6 findings which show that thyroid hormones deficiency in fetal life could influence normal cardiac function and induce cardiac dysfunction in their adult offspring. In addition, pervious reports have demonstrated that lower baseline hemodynamic parameters and cardiac failure are the common outcomes of adult hypothyroidism.11,17
The mechanisms of the effects of thyroid hormones deficiency in fetal life on cardiac development and function during adulthood have not been clearly elucidated. In this study, we showed for the first time that thyroid hormones deficiency in fetal life is associated with increased β-MHC expression [2.11 fold higher expression (201%) than control] and decreased α-MHC expression [0.63 fold lower expression (47%) than control]. No report has however been documented regarding the changes in α- and β-MHC expression in FH rats; previous reports have represented that the induction of hypothyroidism during adult life leads to a shift from α- to β-MHC.9,10,18 Increased expression of β-MHC in the heart tissue, a frequent aspect of cardiac failure, may decrease power output and lead to decreased systolic function in the heart.19 α-MHC had a fast ATPase activity and higher velocity of fiber shortening than β-MHC, so α-MHC: β-MHC ratio in the heart can determine cardiac contractility.20 Hypothyroidism in adult rats leads to the increase expression of β-MHC and decrease velocity of fiber shortening and, then, diminishes cardiac contractility.20,21 Chizzonite R.A. et al. reported that an increase in α-MHC observed after birth was concurrent with a remarkable increase in the serum level of thyroid hormones.18
Of other possible molecular mechanisms involved in the effect of FH on cardiac function, Chizzonite et al.18 reported that fetal hypothyroidism delayed the shift of β-MHC (embroyonic MHC in rats) to α-MHC (adult MHC in rats) and caused cardiac disability. Wibo et al.22 also reported that the maturation of dihydropyridine receptor (a voltage L type calcium channel) was postponed after the induction of hypothyroidism in fetal and neonate rats and induced ionic imbalance in the heart tissue. In addition, Meehan et al.23 reported that thyroid hormone deficiency in fetal life decreased the level of energy in cardiac cells due to the reduction in the expression of cytochrome c oxidase isoforms and vital enzyme for the production of energy in the electron transport chain in the heart tissue during development period. According to the result from this study and previous reports, it is hence possible for the decrease of cardiac function in the FH rats to be related to the increased expression of β- to α- MHC ratio and deregulation in cytochrome c oxidase isoforms expression and dihydropyridine receptor, all of which could contribute to the power of cardiac function.
Regarding the limitations of this study, our results were limited to male rats, and fetal hypothyroidisms could affect cardiac functions in both sexes. In addition, we used the Langendorff-perfused heart model for the measurement of cardiac function; it has been however reported that using in vivo model is clinically more relevant.
Conclusion
Thyroid hormone deficiency during fetal life could attenuate the normal cardiac functions in adult rats, an effect at least in part due to the increased expression of β- to α- MHC ratio in the heart.
Sources of Funding
This study was funded by Drug Applied Research Center, Tabriz University of Medical Sciences.
Study Association
This article is part of the PhD thesis submitted by Nasibeh Yousefzadeh, from Tabriz University of Medical Sciences.
Acknowledgments
The Grant of this study was supported by Drug Applied Research Center of Tabriz University of Medical Sciences, Tabriz, Iran. Our data in this work were derived from the thesis of Ms. Nasibeh Yousefzadeh for a PhD degree in physiology (thesis serial number: 94/5-6/1).
References1 De Boo HA, Harding JE. The developmental origins of adult disease (Barker) hypothesis. Aust N Z J Obstet Gynaecol. 2006;46(1):4-14.De BooHAHardingJEThe developmental origins of adult disease (Barker) hypothesisAust N Z J Obstet Gynaecol20064614142 Fowden AL, Giussani DA, Forhead AJ. Intrauterine programming of physiological systems: causes and consequences. Physiology (Bethesda). 2006;21:29-37.FowdenALGiussaniDAForheadAJIntrauterine programming of physiological systems: causes and consequencesPhysiology (Bethesda)20062129373 Bourguignon JP, Parent AS. Early homeostatic disturbances of human growth and maturation by endocrine disrupters. Curr Opin Pediatr. 2010;22(4):470-7.BourguignonJPParentASEarly homeostatic disturbances of human growth and maturation by endocrine disruptersCurr Opin Pediatr20102244704774 Patel J, Landers K, Li H, Mortimer RH, Richard K. Thyroid hormones and fetal neurological development. J Endocrinol. 2011;209(1):1-8.PatelJLandersKLiHMortimerRHRichardKThyroid hormones and fetal neurological developmentJ Endocrinol20112091185 Thornburg KL. Foetal programming reveals the dark side of AT(2)R. Cardiovasc Res. 2011;89(2):260-1.ThornburgKLFoetal programming reveals the dark side of AT(2)RCardiovasc Res20118922602616 Ghanbari M, Jeddi S, Bagheripuor F, Ghasemi A. The effect of maternal hypothyroidism on cardiac function and tolerance to ischemia-reperfusion injury in offspring male and female rats. J Endocrinol Invest. 2015;38(6):915-22.GhanbariMJeddiSBagheripuorFGhasemiAThe effect of maternal hypothyroidism on cardiac function and tolerance to ischemia-reperfusion injury in offspring male and female ratsJ Endocrinol Invest20153869159227 van Rooij E, Quiat D, Johnson BA, Sutherland LB, Qi X, Richardson JA, et al. A family of microRNAs encoded by myosin genes governs myosin expression and muscle performance. Dev Cell. 2009;17(5):662-73.van RooijEQuiatDJohnsonBASutherlandLBQiXRichardsonJAA family of microRNAs encoded by myosin genes governs myosin expression and muscle performanceDev Cell20091756626738 Oliveira-Carvalho V, Carvalho VO, Bocchi EA. The emerging role of miR-208a in the heart. DNA Cell Biol. 2013;32(1):8-12.Oliveira-CarvalhoVCarvalhoVOBocchiEAThe emerging role of miR-208a in the heartDNA Cell Biol20133218129 van Rooij E, Sutherland LB, Qi X, Richardson JA, Hill J, Olson EN. Control of stress-dependent cardiac growth and gene expression by a microRNA. Science. 2007;316(5824):575-9.van RooijESutherlandLBQiXRichardsonJAHillJOlsonENControl of stress-dependent cardiac growth and gene expression by a microRNAScience2007316582457557910 Gupta MP. Factors controlling cardiac myosin-isoform shift during hypertrophy and heart failure. J Mol Cell Cardiol. 2007;42(4):388-403.GuptaMPFactors controlling cardiac myosin-isoform shift during hypertrophy and heart failureJ Mol Cell Cardiol200742438840311 Jeddi S, Zaman J, Ghasemi A. Effects of ischemic postconditioning on the hemodynamic parameters and heart nitric oxide levels of hypothyroid rats. Arq Bras Cardiol. 2015;104(2):136-43.JeddiSZamanJGhasemiAEffects of ischemic postconditioning on the hemodynamic parameters and heart nitric oxide levels of hypothyroid ratsArq Bras Cardiol2015104213614312 Yousefzadeh N, Alipour MR, Soufi FG. Deregulation of NF-small ka, CyrillicB-miR-146a negative feedback loop may be involved in the pathogenesis of diabetic neuropathy. J Physiol Biochem. 2015;71(1):51-8.YousefzadehNAlipourMRSoufiFGDeregulation of NF-small ka, CyrillicB-miR-146a negative feedback loop may be involved in the pathogenesis of diabetic neuropathyJ Physiol Biochem2015711515813 Vincent MA, Rodd C, Dussault JH, Van Vliet G. Very low birth weight newborns do not need repeat screening for congenital hypothyroidism. J Pediatr. 2002;140(3):311-4.VincentMARoddCDussaultJHVan VlietGVery low birth weight newborns do not need repeat screening for congenital hypothyroidismJ Pediatr2002140331131414 Newsome CA, Shiell AW, Fall CH, Phillips DI, Shier R, Law CM. Is birth weight related to later glucose and insulin metabolism?--A systematic review. Diabet Med. 2003;20(5):339-48.NewsomeCAShiellAWFallCHPhillipsDIShierRLawCMIs birth weight related to later glucose and insulin metabolismo?--A systematic reviewDiabet Med200320533934815 Kuh D, Mishra GD, Black S, Lawlor DA, Davey Smith G, Okell L, et al. Offspring birth weight, gestational age and maternal characteristics in relation to glucose status at age 53 years: evidence from a national birth cohort. Diabet Med. 2008;25(5):530-5.KuhDMishraGDBlackSLawlorDADavey SmithGOkellLOffspring birth weight, gestational age and maternal characteristics in relation to glucose status at age 53 years: evidence from a national birth cohortDiabet Med200825553053516 Forhead AJ, Fowden AL. Thyroid hormones in fetal growth and prepartum maturation. J Endocrinol. 2014;221(3):R87-R103.ForheadAJFowdenALThyroid hormones in fetal growth and prepartum maturationJ Endocrinol20142213R87R10317 Mourouzis I, Dimopoulos A, Saranteas T, Tsinarakis N, Livadarou E, Spanou D, et al. Ischemic preconditioning fails to confer additional protection against ischemia-reperfusion injury in the hypothyroid rat heart. Physiol Res. 2009;58(1):29-38.MourouzisIDimopoulosASaranteasTTsinarakisNLivadarouESpanouDIschemic preconditioning fails to confer additional protection against ischemia-reperfusion injury in the hypothyroid rat heartPhysiol Res2009581293818 Chizzonite RA, Zak R. Regulation of myosin isoenzyme composition in fetal and neonatal rat ventricle by endogenous thyroid hormones. J Biol Chem. 1984;259(20):12628-32.ChizzoniteRAZakRRegulation of myosin isoenzyme composition in fetal and neonatal rat ventricle by endogenous thyroid hormonesJ Biol Chem198425920126281263219 Stelzer JE, Brickson SL, Locher MR, Moss RL. Role of myosin heavy chain composition in the stretch activation response of rat myocardium. J Physiol. 2007;579(Pt1):161-73.StelzerJEBricksonSLLocherMRMossRLRole of myosin heavy chain composition in the stretch activation response of rat myocardiumJ Physiol2007579Pt116117320 Patel M, Mishra V, Pawar V, Ranvir R, Sundar R, Dabhi R. Evaluation of acute physiological and molecular alterations in surgically developed hypothyroid Wistar rats. J Pharmacol Pharmacother. 2013; 4(2):110-5.PatelMMishraVPawarVRanvirRSundarRDabhiREvaluation of acute physiological and molecular alterations in surgically developed hypothyroid Wistar ratsJ Pharmacol Pharmacother20134211011521 Dillmann WH. Biochemical basis of thyroid hormone action in the heart. Am J Med. 1990;88(6):626-30.DillmannWHBiochemical basis of thyroid hormone action in the heartAm J Med199088662663022 Wibo M, Feron O, Zheng L, Maleki M, Kolar F, Godfraind T. Thyroid status and postnatal changes in subsarcolemmal distribution and isoform expression of rat cardiac dihydropyridine receptors. Cardiovasc Res.1998;37(1):151-9.WiboMFeronOZhengLMalekiMKolarFGodfraindTThyroid status and postnatal changes in subsarcolemmal distribution and isoform expression of rat cardiac dihydropyridine receptorsCardiovasc Res199837115115923 Meehan J, Kennedy JM. Influence of thyroid hormone on the tissue-specific expression of cytochrome c oxidase isoforms during cardiac development. Biochem J. 1997; 327 (Pt 1):!55-60.MeehanJKennedyJM.Influence of thyroid hormone on the tissue-specific expression of cytochrome c oxidase isoforms during cardiac developmentBiochem J1997327Pt 15560Artigo OriginalO Efeito de Hipotireoidismo Fetal na Expressão da Miosina Cardíaca de Cadeia Pesada em Ratos MachoYousefzadehNasibeh1JeddiSajad2AlipourMohammad Reza1Drug Applied Research Center, Tabriz University of Medical Sciences, Tabriz, IranEndocrine Physiology Research Center, Research Institute for Endocrine Sciences, Shahid Beheshti University of Medical Sciences, Tehran - IranCorrespondência: Mohammad Reza Alipour, Drug Applied Research Center, Tabriz University of Medical Sciences. Postal Code: 5166614766, Tabriz - Iran. E-mail: alipourmr@tbzmed.ac.ir, alipourmr52@gmail.com
Contribuição dos autores
Concepção e desenho da pesquisa, Obtenção de dados, Análise e interpretação dos dados e Redação do manuscrito: Jeddi S, Yousefzadeh N, Alipour MR; Análise estatística: Yousefzadeh N, Alipour MR; Obtenção de financiamento e Revisão crítica do manuscrito quanto ao conteúdo intelectual importante: Alipour MR.
Potencial conflito de interesse
Declaro não haver conflito de interesses pertinentes.
ResumoFundamento:
Deficiência de hormônio da tireoide durante vida fetal pode afetar a função cardíaca no futuro. O mecanismo subjacente dessa ação em hipotireoidismo fetal (HF) em ratos ainda não tem explicação.
Objetivo:
O objetivo desse estudo é avaliar o efeito de HF na função cardíaca em ratos macho e determinar a contribuição da α-miosina de cadeia pesada (α-MCP) e de isoformas β-MCP.
Métodos:
Seis ratos fêmea gestantes foram aleatoriamente divididas em dois grupos. O grupo do hipotireoidismo recebeu água contendo 6-propil-2-tiouracil durante a gestação, e os ratos no grupo de controle receberam água de torneira. Os filhotes dos ratos foram testados quando atingiram idade adulta. O coração dos ratos HF e controle foram isolados e submetidos a perfusão pelo método de Langendorff para medição de parâmetros hemodinâmicos. Também foram medidas as expressões de mRNA do coração de α-MCP e β-MCP por qPCR.
Resultados:
PVED de base (74,0 ± 3,1 vs. 92,5 ± 3,2 mmHg, p < 0,05) e pressão arterial (217 ± 11 vs. 273 ± 6 batidas/min, p < 0,05) mostraram-se mais baixas em ratos HF do que em ratos controle. Além disso, esses resultados mostraram a mesma significância em ±dp/dt. Em ratos HF, a expressão de β-MCP foi mais alta (201%) e a de α-MCP foi mais baixa (47%) do que em ratos controle.
Conclusão:
Deficiência de hormônio da tireoide durante a vida fetal pode enfraquecer funções cardíacas normais em ratos adultos, efeito devido em parte à expressão aumentada de β-MCP em relação a α-MCP no coração.
Estudos anteriores mostraram que muitas das doenças que ocorrem na idade adulta, como diabetes, hiperlipidemia e doenças cardiovasculares, são resultado de restrição de crescimento intra-uterino (RCIU).1 A RCIU pode ser causada por diversos fatores, incluindo desnutrição, estresse e distúrbios endócrinos como alterações na tireoide.2,3
Hormônios da tireoide têm um papel importante no desenvolvimento e crescimento de diversos órgãos durante a vida, especialmente nos períodos fetal e pré-natal.4 Há relatos de que a diminuição dos níveis de hormônios da tireoide durante a vida fetal (hipotireoidismo fetal) em ratos é causadora de RCIU e induz disfunção cardíaca no futuro.5,6 Porém, mecanismos subjacentes ainda não foram compreendidos.
A miosina de cadeia pesada (MCP) é a principal proteína contrátil do tecido cardíaco e principal reguladora da função e contratilidade cardíaca, o que representa duas isoformas MCP: α-MCP e β-MCP.7,8 A proporção das isoformas α-MCP e β-MCP pode variar de acordo com o estágio de desenvolvimento, e mudanças nesta relação prejudicam a contratilidade cardíaca.7 O aumento da expressão de β-MCP no coração, característica comum de insuficiência cardíaca, pode ser induzido por estresse mecânico e hipotireoidismo.9,10
Até onde sabemos, não há relatos documentados que abordem o mecanismo de insuficiência cardíaca em ratos com hipotireoidismo fetal (HF); o objetivo de nosso estudo é, portanto, determinar se mudanças na expressão de genes α-MCP e β-MCP estão envolvidas na disfunção cardíaca em ratos com hipotireoidismo fetal.
MétodosAnimais
Ratos Wistar macho e fêmea foram mantidos num biotério com temperatura de 2 ± 3°C, humidade relativa de 50 ± 6%, e tiveram acesso livre a ração padrão e água de torneira durante o estudo. Os animais foram adaptados a um ciclo de claro/escuro a cada período de 12 horas. Todos os procedimentos empregados, bem como manuseio e cuidados com os ratos, estavam de acordo com diretrizes fornecidas pelo comitê de ética local.
Indução de hipotireoidismo fetal
Seis ratos Wistar fêmeas virgens (pelo corpóreo = 200 ± 10 g) foram mantidas durante a noite com ratos macho (peso corpóreo = 300 ± 20 g) (duas fêmeas e um macho por gaiola) na fase de proestro determinada por esfregaços vaginais para o acasalamento. As fêmeas gestantes foram aleatoriamente dividas em: 1 - Consumo de 0,025% de 6-propil-2-tiouracil (PTU) durante a gestação e 2 - O grupo de mães de controle. Após a divisão, as fêmeas foram transferidas para gaiolas separadas. As mães que consumiram o PTU, tiveram a substância misturada na água durante a gestação (consumo iniciado no primeiro dia da gestação e descontinuado após o parto) e as mães do grupo de controle receberam apenas água de torneira. Após serem desmamados, os filhotes macho das mães foram separados e divididos em dois grupos: HF (n = 8) e controles (n = 8) e foram mantidos em grupos de quatro por gaiola com acesso livre a comida e água. Nesse estudo, os ratos no grupo de controle e HF foram divididos em dois subgrupos, e em seguida foram feitos o estudo funcional e a análise molecular. Após o nascimento, o peso dos filhotes em todos os grupos foi medido mensalmente, do primeiro dia de vida até o final do terceiro mês. Além disso, o ganho de peso até 3 meses de idade foi medido nos grupos controle e HF.
Medições T3 e T4
Para avaliar o status da função da tireoide, amostras de sangue foram obtidas - da mãe após o parto e dos filhotes no dia do nascimento e aos 3 meses de idade - centrifugadas (3000 × g, 10 min a 4°C), e o soro foi armazenado a -80°C até o momento do ensaio. Os níveis de triiodotironina total (TT3) e tiroxina total (TT4) foram medidos por kit ELISA (Pishtazteb Company, Irã). Coeficientes de variação inter e intra- ensaios foram de 3,6 e 4,7% para T3 e 5,8 e 6,3% para T4, respectivamente.
Medição dos parâmetros hemodinâmicos
Todos os ratos aos 3 meses de idade foram anestesiados por injeção intraperitoneal de cetamina e xilazina (60 mg/kg e 10 mg/kg). O coração dos ratos controle e HF foram rapidamente excisados e imerso num tampão de perfusão gelada; aortas foram então canuladas e os corações foram fixados no modo de pressão constante do aparelho de perfusão de Langendorff e perfundidos através da aorta com a solução Krebs-Henseleit (pH = 7,4) contendo (mmol/L): NaCl 118, NaHCO3 25, KCl 4,7, MgCl2 1,2, CaCl2 2,5, KH2PO4 1,2 e glicose 11; A pressão de perfusão da solução foi constantemente ajustada em 75 mmHg e a solução Krebs foi gaseificada com a mistura de 95% O2 e 5% CO2 a 37°C.
Um balão de látex foi inserido no ventrículo esquerdo para permitir a medição da pressão ventricular esquerda desenvolvida (PVED), das taxas de pico de alterações positivas (+dP/dt) e negativas (-dp/dt) na pressão do ventrículo esquerdo e da frequência cardíaca (FC). Parâmetros hemodinâmicos (FC, PVED e ±dp/dt) foram digitalizados por um sistema de Power Lab (AD instrument, Australia).11
Isolamento de RNA, síntese de cDNA e PCR em tempo real quantitativo
O RNA total foi extraído do ventrículo esquerdo dos corações por meio de kit de solução RNX-Plus (Fermentase, Cinagen Co. Irã) de acordo com instruções do fabricante. A quantidade e a pureza do RNA foram medidas por meio do NanoDrop 1000 (Thermo Scientific, Waltham, and Mass). A expressão dos genes α-MCP e β-MCP foram avaliadas quantativamente por reação em cadeia da polimerase em tempo real, sequências de iniciadores para cada gene foram escolhidas com Gene-Runner Software, versão 3.05 (Tabela 1). Para síntese de cDNA, o RNA total foi transcrito de forma inversa por meio de Revert Aid M-MuLV transcriptase reversa, dNTPs, iniciadores hexâmeros aleatórios, DNase I e inibidor de ribonuclease RiboLock, durante 10 min a 25°C, seguido de 60 min a 42°C num volume final de 20 µl. A reação foi terminada pelo aquecimento a 70°C por 5 min.
Sequências de iniciadores
Genes
Sequência de Iniciadoresa
α-MCP
F: GCTGGAGCTGATGCACCTGT
R: TCGGCATCTGCCAGGTTGTC
β-MCP
F: TCGGGAAGCAGTGCCAGAAC
R:AGGAGCAGGAAGGGTCGGTT
β-actina
F: TACAGCTTCACCACCACAGC
R: ATGCCACAGGATTCCATACC
Sequências derivadas de NCBI (www.ncbi.nlm.nih.gov). MCP: miosina de cadeia pesada.
Uma mistura principal contendo 12,5 µl SYBR PCR verde Master Mix (Fermentase, Germany), 8,5 µl de água e 2 µl de iniciador direto e iniciador reverso num volume final de 25 µl foi preparado para realizar PCR em tempo real. Dois microlitros de cDNA transcrito de forma inversa foram então adicionados à mistura principal PCR para chegar ao volume final de 25 µl. Reações sem padrão foram incluídas como controles negativos.
O protocolo de PCR foi usado no aparelho de PCR em tempo real (Rotor-Gene 3000) em três etapas, incluindo: 1 - desnaturação inicial (10 min a 95°C), 2 - programa de amplificação de três passos (15 s a 95°C seguido de 30 s a 60°C para genes α-MCP e β-MCP, e 30 s a 72°C) repetido 40 vezes, e 3 - análise da curva de fusão (1 ciclo: 72 a 95°C com taxa de transição de temperatura a 1°C/seg por 5 segs). Quantificação em tempo real foi monitorada pela medição do aumento em fluorescência causado pela ligação do corante SYBR verde ao DNA de cadeia dupla ao final de cada ciclo de amplificação. Todos os ensaios foram realizados em duplicado. A quantidade relativa de mRNA para cada gene alvo foi calculada com base ciclo limiar (Ct) comparado ao Ct do gene housekeeping (gene de referência) (β-actina). A quantificação relativa foi feita pelo método 2(-∆ )(∆)( Ct )conforme descrito a seguir:12
2-[( gene alvo Ct - gene de referência Ct) experimental - (gene alvo Ct - gene de referência Ct) controle]. A especificidade das reações PCR foi verificada pela geração de análise da curva de fusão.
Análise estatística
Todos os valores foram expressos como média ± EPM. A análise estatística foi feita por meio do software SPSS (SPSS, Chicago, IL, USA; versão 20). O teste Shapiro-Wilk foi usado para checar a normalidade dos dados estudados e, depois, os testes paramétrico ou não paramétrico foram usados para a análise da distribuição normal ou não-normal de dados, respectivamente.13 Portanto, o teste de amostra t de Student foi usado para comparar níveis de hormônio de tireoide, PVED, FC, ±dp/dt e massa corpórea entre os grupos. O teste de Mann-Whitney também foi usado para comparar a expressão de genes entre os dois grupos. Valores bilaterais de p < 0,05 foram considerados estatisticamente significativos.
Resultados
Os efeitos da administração de PTU nos níveis de hormônio da tireoide durante a gestação (T3 e T4 total) no soro das mães estão demonstrados na Figura 1A. Conforme vemos, as mães que consumiram PTU durante a gestação tiverem T3 e T4 total mais baixo no soro em comparação ao grupo de controle (p < 0,05). T3 e T4 total no soro dos filhotes após administração de PTU em mães gestantes estão demonstrados na Figura 1B e 1C. Na hora do nascimento, os filhotes tinham T3 e T4 total mais baixo no soro em comparação ao grupo de controle (p < 0,05) (Figura 1B), ao passo que na vida adulta (terceiro mês), não foi encontrada diferença significativa entre os dois grupos (Figura 1C).
Concentrações de soro T3 e T4 na mãe (A), neonatos (B) e 3 meses de idade (C) no hipotireoidismo fetal, e ratos controle. Valores são média ± EPM. *p < 0,05, diferenças estatisticamente significativas entre hipotireoidismo e controles em mães e hipotireoidismo e controles em filhotes (n = 8 ratos). T4: Tiroxina; T3: triiodotironina; HF: hipotireoidismo fetal.
A Figura 2 mostra os efeitos da deficiência do hormônio da tireoide durante a vida fetal no peso corporal (do nascimento aos três anos de idade). Conforme demonstrado, o peso corporal no nascimento estava significativamente mais baixo em ratos HF do que em ratos controle. Além disso, o ganho de peso até 3 meses de idade foi significativamente menor em ratos HF do que em controles.
Peso corporal em ratos com hipotireoidismo fetal e controles. Valores são média ± EPM. *p < 0,05, diferenças estatisticamente significativas entre ratos com hipotireoidismo fetal e ratos controle (n = 8 ratos). HF: Hipotireoidismo fetal.
Parâmetros hemodinâmicos, incluindo PVED, ±dp/dt e frequência cardíaca nos filhotes (aos 3 meses de idade) que tinham deficiência de hormônio da tireoide durante a vida fetal estão descritos na Figura 3. O nível basal de PVED nos ratos HF estava significativamente mais baixo do que nos ratos controle (Figura 3A) (p < 0,05). Além disso, ratos HF tiveram níveis basais de frequência cardíaca e de +dp/dt e -dp/dt mais baixos do que os controles (Figuras 3B, 3C e 3D, respectivamente) (p < 0,05).
Parâmetros hemodinâmicos no hipotireoidismo fetal e ratos controle. A) Pressão ventricular esquerda desenvolvida (PVED), B) Frequência cardíaca, C) Taxas de pico de mudanças positivas na pressão ventricular esquerda (+dp/dt), D) Taxas de pico de mudanças negativas na pressão ventricular esquerda (-dp/dt). Valores são média ± EPM, (n = 8 ratos), *p < 0,05, diferenças estatisticamente significativas entre ratos com hipotireoidismo fetal e ratos controle. HF: Hipotireoidismo fetal.
Os efeitos deficiência de hormônio da tireoide durante a vida fetal nas expressões de β-MCP e α-MCP nos filhotes de 3 meses de idade estão demonstrados na Figura 4. Nos ratos HF, a expressão de β-MCP estava mais alta (201%) (Figura 4A) (p < 0,05) e a expressão de α-MCP estava mais baixa (47%) em comparação aos ratos controle (Figura 4B) (p < 0,05).
Expressão de genes em corações de ratos com hipotireoidismo fetal e ratos controle. MCP: miosina de cadeia pesada *p < 0,05. Dados foram normalizados ao calibrador (definido em 1) e apresentados como média ± EPM. HF: Hipotireoidismo fetal.
Discussão
Nossos resultados mostraram que a deficiência de hormônios da tireoide na vida fetal poderia enfraquecer as funções cardíacas normais, incluindo PVED, FC e ±dp/dt durante a idade adulta. A disfunção cardíaca em ratos HF é, pelo menos em parte, causada pelo aumento da expressão de β-MCP e diminuição da-expressão de α-MCP.
Nesse estudo, ratos HF tiveram menor ganho de peso até os 3 meses de idade, resultado esse coerente com estudos prévios.6,13 Relatos anteriores mostraram que baixo peso de nascimento é um fator de risco para futuras doenças na idade adulta em humanos e animais, incluindo doenças cardiovasculares.2,14,15
Relatos anteriores também demonstraram que funções cardiovasculares podem ser afetadas pela RCIU.5 No presente estudo, o consumo de PTU pelas mães durante o período gestação induziu RCIU nos filhotes. Há relatos de que a deficiência de hormônio da tireoide na vida fetal causa RCIU.6 Resultados desse estudo demonstraram que mães com hipotireoidismo, no momento do parto, e seus filhotes, na hora do nascimento, tinham níveis mais baixos de hormônios da tireoide (níveis T3 e T4 total) em comparação ao controle correspondente. Porém, os níveis desses hormônios mostraram-se normais nos filhotes na vida adulta, indicando que os ratos HF apresentavam deficiência de hormônios da tireoide apenas no período fetal. Estudos prévios indicaram que hormônios da tireoide são necessários para o desenvolvimento e função cardíaca normal durante a vida, especialmente na vida fetal.6,6
Nesse estudo, ratos HF apresentaram níveis basais mais baixos de PVED, ±dp/dt, e de frequência cardíaca em comparação aos controles. Diminuições observadas em PVED, ±dp/dt e também na frequência cardíaca nesse estudo foram similares àquelas observadas em relatos anteriores,6 descobertas que mostram que a deficiência de hormônios da tireoide na vida fetal pode influenciar a função cardíaca normal e induzir disfunção cardíaca nos filhotes adultos. Além disso, relatos anteriores demonstraram que parâmetros hemodinâmicos basais mais baixos e insuficiência cardíaca são desfechos comuns de hipotireoidismo adulto.11,17
Os mecanismos dos efeitos da deficiência de hormônios da tireoide durante a vida fetal no desenvolvimento e função cardíaca na vida adulta ainda não são claramente compreendidos. Neste estudo, mostramos pela primeira vez que a deficiência de hormônios da tireoide na vida fetal está associada ao aumento da expressão de β-MCP [2,11 vezes mais alta (201%) do que no grupo controle]. Não há, contudo, relatos documentados sobre as alterações nas expressões α- e β-MCP em ratos HF; relatos anteriores demonstraram que a indução de hipotireoidismo durante a vida adulta leva a uma mudança de α- para β-MCP.9,10,18 Expressão elevada de β-MCP no tecido cardíaco, aspecto frequente de insuficiência cardíaca, pode diminuir a produção de energia e levar a uma diminuição da função sistólica cardíaca.19 A α-MCP teve rápida atividade de ATPase e maior velocidade de encurtamento das fibras do que β-MCP, portanto a relação α-MCP: β-MCP no coração pode determinar contratilidade cardíaca.20 O hipotireoidismo em ratos adultos leva ao aumento da expressão da β-MCP e velocidade diminuída de encurtamento de fibra e, depois, reduz a contratilidade cardíaca.20,21 Chizzonite e Zak18 relataram que um aumento na α-MCP observado após o nascimento era concordante com aumento expressivo no nível sérico dos hormônios da tireoide.
Entre outros possíveis mecanismos moleculares envolvidos no efeito de HF na função cardíaca, Chizzonite e Zak18 relataram que o hipotireoidismo fetal atrasa a mudança de β-MCP (MCP embrionária em ratos) para α-MCP (MCP adulta em ratos) e causa deficiência cardíaca. Wibo et al.22 também relataram que a maturação do receptor de dihidropiridina (canal de cálcio tipo L voltagem) foi adiada após a indução do hipotireoidismo em ratos em vida fetal e neonatal, e induziu desequilíbrio iônico no tecido cardíaco. Além disso, Meehan e Kennedy23 relataram que a deficiência de hormônios da tireoide na vida fetal diminuía o nível de energia nas células devido à redução na expressão de isoformas de citocromo c oxidase e enzimas vitais para a produção de energia na cadeia de transporte de elétrons no tecido cardíaco durante o período de desenvolvimento. De acordo com resultados desse estudo e relatos prévios, é então possível que a redução da função cardíaca em ratos HF esteja relacionada ao aumento da expressão da relação β- para α- MCP e à desregulação da expressão de isoformas de citocromo c oxidase e receptor de dihidropiridina - todos esses fatores que poderiam contribuir com a potência da função cardíaca.
Em relação às limitações do estudo, os resultados foram limitados a ratos machos, e o hipotireoidismo fetal pode afetar funções cardíacas em ambos os sexos. Além disso, utilizou-se o modelo de coração perfundido pelo método de Langendorff-para a medição da função cardíaca; no entanto, já foi relatado que o uso de modelo in vivo é clinicamente mais relevante.
Conclusão
Deficiência de hormônio da tireoide durante a vida fetal pode enfraquecer funções cardíacas normais em ratos adultos, efeito pelo menos em parte devido ao aumento da expressão da relação de β- para α- MCP no coração.
Fontes de financiamento
O presente estudo foi financiado pela Drug Applied Research Center, Tabriz University of Medical Sciences.
Vinculação acadêmica
Este artigo é parte de tese de Pós-Doutorado de Nasibeh Yousefzadeh pela Tabriz University of Medical Sciences.
Agradecimentos
Esse estudo foi apoiado pelo Centro de Pesquisas Aplicadas a Medicamentos da Universidade de Ciências Médicas de Tabriz, Irã. Nossos dados nesse trabalho foram derivados da tese de PhD em fisiologia de Ms. Nasibeh Yousefzadeh (número de série da tese: 94/5-6/1)